1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marrrta [24]
2 years ago
11

How do the number of chromosomes in cells that go through meiosis and mitosis compare?

Biology
1 answer:
34kurt2 years ago
6 0

Answer: Option A is correct.

Cells that go through meiosis have half as many chromosomes as cell that go through mitosis. Meiosis is that's why called REDUCTION DIVISION.

Explanation:

In meiosis, the number of chromosomes becomes half or reduced than the normal while, in mitosis the number of chromosomes remains the same.

You might be interested in
please help this is for a presentation.. Is the spongy parenchyma cell unicellular or multicellular?​
qaws [65]
It is Multicellular
8 0
2 years ago
From left to right, which is the sequence of the<br> complementary strand of DNA in this molecule?
ladessa [460]

Answer: Option A) A-C-T-T-G

Explanation:

The base sequence on a strand of DNA is usually paired to specific complimentary bases. These specific pairings are as follows:

Adenine (A) pairs with Thymine (T)

Guanine (G) pairs with Cytosine (C). So when you find A replace with T, so also replace C with G and vice versa.

Thus, the complimentary sequence of the T-G-A-A-C DNA strand is A-C-T-T-G

4 0
3 years ago
What would happen if another substance competed for the enzyme active site?
Lelu [443]
That's what is called competitive enzymatic regulation. If there are more of that substance than the enzyme substrate, then most of the enzyme, if not all depending on the substance's concentration, will be inhibited on its action. If there are more substrate then the competitive substance, the expected reaction for that enzyme will happen at an expected rate. If the ratio substrate:substance is 1:1 then the reaction enzyme-substrate is very slowed down.
6 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
The most common source of activity limitation in early adulthood is
mihalych1998 [28]

Arthritis

Arthritis is a joint disorder in which there is inflammation of one or more joints.  Arthritis is frequently accompanied by joint pain. There are many types of arthritis and over 100 have been identified. The causes of arthritis include injury, metabolic abnormalities, hereditary factors, effect of infections, and a misdirected immune system. Arthritis is mostly common among women and occurs as people get older. Severe arthritis can result in chronic pain, inability to do daily activities and can cause difficulty in walking.






3 0
3 years ago
Other questions:
  • What connects the brain and spinal cord to the rest of the body
    5·2 answers
  • What can be found in every skeletal muscle
    5·2 answers
  • 1. What would be the net gain of ATP from the breakdown of ten molecules of glucose under aerobic conditions?
    9·2 answers
  • Which of the following statements is/are true with regard to a polymer of 6 glucose molecules?
    15·1 answer
  • It is important to remove any big air bubbles from the microtubes prior to incubation. Otherwise, the bubbles could:_______.
    5·1 answer
  • What are the 6 types of fossils
    13·1 answer
  • If the concentration of oxygen in a body tissue cell is 5% and the concentration of oxygen in the blood surrounding the
    12·1 answer
  • Bile
    7·1 answer
  • Based on the diagram below, which of the following characteristics should appear at position X on the chart?
    13·1 answer
  • True or false: Selective breeding has been used to produce crops with greater yields.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!