Answer:
Robert Hazen’s studied enviromental and biological processes that might have been critical for life, and also for the formation of approximately two-thirds of Earth's mineral species (see Hazen et al., 2008; Gonzalez & Richards 2020)
.
Explanation:
Hazen provided evidence about how first organic molecules were generated on the primitive earth millions of years ago. He observed that high-pressure hydrothermal vents may provide food for underwater ecosystems. It represents a piece of critical evidence on the origin of life.
You can read these articles that are certainly clarifying in the description of his experiments and discoveries:
1- Hazen, R. M., Papineau, D., Bleeker, W., Downs, R. T., Ferry, J. M., McCoy, T. J., ... & Yang, H. (2008). Mineral evolution. American Mineralogist, 93(11-12), 1693-1720.
2- Gonzalez, G., & Richards, J. W. (2020). The privileged planet: how our place in the cosmos is designed for discovery. Gateway Editions.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
They Are Trying To Ban The Actions Of The Use Of Toxins In Oceans ,, Banning Ocean Dumping Into The Waters ,, Protecting Sensitive Areas From Oil Drilling And Oil Transportations ,, The Regulation Of Coastal Development ,, And The Regulation. Of Sewage Treatment .
Your answer would be Water. :)
