Answer:
Two women can be selected from 29 in 29C2 ways.
Explanation:
plato
It is Washington DC.
It is the location of the White House, which is where the white president lives.
A fact is a pragmatic truth, a statement that can, at least in theory, be checked and confirmed. Facts are often contrasted with opinions and beliefs, statements which are held to be true, but are not amenable to pragmatic confirmation.The word fact derives from the Latin Factum, and was first used in English with the same meaning: "a thing done or performed", a use that is now obsolete. The common usage of, "something that has really occurred or is the case", dates from the middle of the sixteenth century. Fact is sometimes used as synonymous with truth or reality, as distinguishable from conclusions or opinions. This use is found in such phrases Matter of fact, and "... not history, nor fact, but imagination."
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
The answer is B. The lines of Latitude are about 69 miles apart. Each line of latitude is 1 degree of the angle of circumference of the earth, with parallel latitude lines lined up going East-West. Since the lines are stacked up north to south, your latitude describes your North/South position on the earth. Since these lines are parallel, their distance in generally constant.
