1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VashaNatasha [74]
2 years ago
15

What are organelles made of

Geography
1 answer:
RSB [31]2 years ago
8 0

Answer:

All the cellular organelles are made of macromolecules like carbohydrates, Lipids, Proteins, and Nucleic acids (DNA, RNA). Atoms - To make macromolecules involves even smaller building blocks. You may have heard of atoms before and their parts: neutrons, protons, and electrons.

Explanation:

You might be interested in
What is supraorbital height
quester [9]
It is the bony ridge located above the eye socket of all primates
5 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
2 years ago
The himalayan mountains are located at what boundary?
devlian [24]

Answer: The Himalayan Mountains are at a convergence plate boundary between the Eurasian plate and the Indian plate.

Brainliest please

8 0
3 years ago
The accumulation of sediment found along the shore of a lake or ocean is called a
Studentka2010 [4]

The answer to your question is: Abrasion.

Abrasion occurs when sediments that are located on the shore of a lake, and an ocean accumulate along the shore.

The accumulation of sediment found along the shore of a lake or ocean is called a<em> Abrasion.</em>

I hope this helps! :)

Have a wonderful day!

-LizzyIsTheQueen

3 0
3 years ago
The equator and prime meridan meet closet to the continent of
wel
The equator and prime meridian meet closet to the continent of Africa.

Hope this helps! XD :)
6 0
3 years ago
Other questions:
  • The division of geology concerned with earth materials, changes in the surface and interior of the earth, and the dynamic forces
    9·2 answers
  • Granite is _____. found in continental crust formed from contact metamorphism a chemical sedimentary rock an extrusive igneous r
    8·2 answers
  • When various cultures combine their own religions, language, dress, food, and customs to form one peopleit is called
    10·2 answers
  • The Third Agricultural Revolution is also called the: A. British Agricultural Revolution B. Green Revolution C. Harbinger Revolu
    9·2 answers
  • ___Is a poor conductor of heat?<br><br><br> Aluminum?<br> Iron?<br> Ceramic?<br> Or Zinc?
    8·2 answers
  • What are the sources of the energy that drives the earth’s processes?
    6·1 answer
  • What problems did the construction of the Aswan High Dam create for the people of Egypt and their environment?
    7·2 answers
  • Which one is the good answer
    10·1 answer
  • What three seas surround the Korean Peninsula?
    11·2 answers
  • State the adaptation of a leaf and the purpose of the adaptations.​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!