1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stiv31 [10]
2 years ago
12

What would be the drug of choice in an adolescent who is diagnosed with syphilis during the first trimester of pregnancy?

Biology
1 answer:
Arisa [49]2 years ago
5 0

Answer:

Penicillin G

Explanation:

I remember this vaguely, remove or whatever if wrong.

You might be interested in
பட்ட
monitta

Answer:

Gametes

Explanation:

Gametes consist of sperm cells and egg cells...

8 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
A substance with pH of 6 is called an?
Nady [450]
A substance with pH 6 would be an acid, because it's 1pH to the left of a neutral substance
3 0
3 years ago
Which structure of human hands makes them especially useful for gripping things? Index finger Middle finger Pinky Thumb
kogti [31]
I beileve it’s the index
5 0
2 years ago
The energy role of the first organism in a food chain is always a(n)______.
Naddik [55]
The first organism in the food chain is the producer.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which enzyme present in saliva helps in digestion of carbohydrates?
    7·1 answer
  • Two alternative futures for cells when they reach their size limitation
    11·1 answer
  • How does burning natural gas influence the carbon cycle?
    15·1 answer
  • Regions of biomes that are an inconsistent mixture of fresh and salt water include ______. Select one: a. ponds b. lakes c. stre
    8·1 answer
  • ¿Para qué los flamencos tienen patas largas?
    13·2 answers
  • Describe what would happen to people who lost their mitochondria and explain why it would happen. Are there any "backup systems"
    11·1 answer
  • In the water cycle shown above, the two processes that involve water entering the atmosphere are: a. Evaporation and transpirati
    6·1 answer
  • Consider that a species of salmon lays 20,000 eggs per pair when it spawns and dies. At the end of five years, an average of one
    8·1 answer
  • Amino acids bond to each other using hydrogen bonds. true or false
    13·1 answer
  • True or False: New DNA is copied from existing DNA
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!