1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kipiarov [429]
3 years ago
13

What happens when a muscle contracts?

Biology
2 answers:
Gwar [14]3 years ago
6 0
The answer is a) because when muscles contract, myosin heads attach to actin and breaks down ATP. Energy is released, pulling actin filaments and muscle contracts. Essentially actin and myosin filaments are sliding past each other.
agasfer [191]3 years ago
3 0

Answer:

a. Myosin heads attach to and pull on a series of actin-binding sites.

Explanation:

Muscle contraction is a phenomenon whereby the muscles in the body responds to electrical activity also known as stimulus when an action potential travels or moves through the nerve fibres of the muscles.

Muscle contraction is explained by a mechanism known as the Sliding filament mechanism.

Muscle contraction occurs when the protein in the muscles known as Actin and Myosin slide over each other and this is due to the presence sufficient calcium ions which are released by protein filaments also known as sacromeres in the body when they are stimulated.

The calcium ions that are released causes the tropomyosin to detach itself from the binding sites on the actin filaments, allowing myosin heads to bind to the actin which results in the formation of a cross bridge.

The sacromeres then contract and become shorter and this leads to the contraction of the muscles.

You might be interested in
A convergent signal comes from many places to one place true or false?
Studentka2010 [4]
The answer to the question is false that is not true.
6 0
3 years ago
What unique characteristic does the bonding of carbon to other atoms have and why is this important for organic molecules?
Agata [3.3K]

Explanation:

  • The carbon atom has unique properties that allow it to form covalent bonds to as many as four different atoms, making this versatile element ideal to serve as the basic structural component, or “backbone,” of the macromolecules. Individual carbon atoms have an incomplete outermost electron shell.
8 0
3 years ago
The geese and the humans are in competition for something in this area.
Karo-lina-s [1.5K]
Space, is what i would guess.
4 0
4 years ago
Why are manure better than fertilizers​
Irina18 [472]

Manure is better than fertiliser. Manure is derived naturally and adds a lot more than just nutrients to the soil. They increase the activity of the microbes in the soil and increase its fertility. On the other hand, fertilisers harm these microbes and cause health issues in the consumers since they are synthesised chemically.

4 0
3 years ago
Could someone help me out on this problem
Contact [7]
I would go with the first option
3 0
3 years ago
Other questions:
  • Mosquitoes that carry disease-causing organisms from persob to person are called
    11·1 answer
  • Check all ways below to ensure that the bases in RNA are properly paired.
    8·2 answers
  • Sort the following events into two categories:________.
    5·1 answer
  • What type of organism helps to reduce atmospheric carbon dioxide
    7·2 answers
  • Andrew noticed Michael and his pregnant wife Georgette walking down the street and drove his car very close to Michael, and honk
    8·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • This person's job is to ensure tat the trial is fair.
    14·2 answers
  • This water contains a little salt
    5·2 answers
  • within a forest ecosystem, there is a large amount of diversity among members of a warbler species. of the following stages of m
    13·1 answer
  • In your own words, describe the three Law's of Motion.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!