1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
soldi70 [24.7K]
3 years ago
8

Many soils can be distinguished from other samples by their color and texture. True False

Biology
2 answers:
Aneli [31]3 years ago
4 0
 the answer is true 

i hope i helped

Ira Lisetskai [31]3 years ago
3 0

The answer is true . Many soils can be distinguished from other samples by their color or texture

You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Which method of heat transfer can occur in empty space?.
nordsb [41]
Heat radiation.

This is the form of heat transfer that doesn’t need a medium to transfer through.

That’s how heat from the sun gets to earth, even though empty space is very cold.
3 0
3 years ago
Read 2 more answers
How does the information stored in DNA'S nucleotides translate into traits such as eye color and ear shape?
Elden [556K]
<span>Traits are determined by proteins that are built according to the instructions stored in the genes.</span>
8 0
3 years ago
Wann erfolgte der Wurzel der Pflanzen
miv72 [106K]

Answer:

Vor 416 bis 360 Millionen Jahren

Wurzeln waren eine frühe Entwicklung im Pflanzenleben und entwickelten sich an Land während der Devon-Zeit vor 416 bis 360 Millionen Jahren (Gensel et al., 2001; Raven und Edwards, 2001; Boyce, 2005; Kenrick, 2013).

Explanation:

Entschuldigung, wenn das nicht geholfen hat

5 0
3 years ago
A strand of RNA made using the DNA pattern ATCCGTC would have what base sequence?
Ira Lisetskai [31]
<span>would be the DNA match. In RNA, the Ts are replaced by Us, so the RNA match .</span>
4 0
4 years ago
Read 2 more answers
Other questions:
  • Which type of disease might MOST LIKELY be cured by stem cell transplantation?
    11·1 answer
  • A blobfish is a invertebrate right?
    9·1 answer
  • The map shows concentrations of ozone around the world. Ozone shields Earth from harmful ultraviolet light rays from the sun, wh
    6·2 answers
  • A student discovers a mat of green organisms living along the edge of a stream and suspects it is a moss. To confirm that this o
    9·1 answer
  • Meiosis is the process that results in the production of the haploid number of chromosomes.
    13·1 answer
  • What cell part contains an organism’s genome? gene ribosome nucleolus nucleus
    13·2 answers
  • How might a protein lose its structure?
    6·2 answers
  • In pea plants, the allele for tallness (T) is dominant over the allele for shortness (t). If two tall pea plants are crossed, ca
    5·1 answer
  • Meth addiction damages which system
    14·1 answer
  • UPPIO.Stuuyisland.com Earth's Water Systems Tools Save Session Pablo is building a miniature watershed model of his city out of
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!