1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rjkz [21]
2 years ago
9

Which of the following statements are not true about the fossil record

Biology
1 answer:
lions [1.4K]2 years ago
4 0

Answer:

A.

Explanation:

Older fossils tend to lay in the lower levels of the ground. The further up the fossils are, the more likely you are to find something that looks like today. Think of it as stacking papers with different drawings on them from different ages. Oldest goes on the bottom, newest goes on the top. The older layer stands as more of a foundation point while newer layers are around where we are now.

You might be interested in
What is the type of allele that only affects the phenotype in the homozygous condition?
sergeinik [125]
I thinking the answer was for some genes, both alleles express together. Others combine to give an average phenotype....
3 0
3 years ago
Which conditions would be the most favorable for an organism that reproduces asexually?
PtichkaEL [24]
The answer is C 100% sure
4 0
3 years ago
Read 2 more answers
What level of organization is represented by the brain
Bogdan [553]

Cell,tissues ,Organs and Organ Systems. After tissues, organs are the next level of organization of the human body. An organ is a structure that consists of two or more types of tissues that work together to do the same job. Examples of human organs include the brain, heart, lungs, skin, and kidneys

8 0
3 years ago
The limbic system is responsible for ____________. connecting the brain to the rest of the body fighting disease organisms that
Nina [5.8K]

The limbic system is responsible for controlling learning and emotional behavior

5 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Other questions:
  • Describe how proteins are made, packaged, and transported within the cell.
    7·2 answers
  • As part of an experiment to measure decomposition rates of different materials, students put food scraps from the cafeteria in c
    14·1 answer
  • Cell membranes are said to be selectively permeable. Which statement best explains what selectively
    11·2 answers
  • Describe the structure of the layers of the skin (pp.178-184)
    11·1 answer
  • Which of the following best pairs Darwin's contributor to his ideas?
    14·1 answer
  • __________ helps organisms transport nutrients.<br> a. soil<br> b. sap<br> c. water<br> d. wind
    5·1 answer
  • An amplified recording of the waves of electrical activity that sweep across the surface of the brain is called a(n):_______
    13·2 answers
  • Which of the following is the correct equation for photosynthesis?
    13·1 answer
  • Tylenol is the Name for the drug acetaminophen
    10·1 answer
  • The example of protective food is​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!