1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
guapka [62]
3 years ago
14

"an air mass from the gulf of mexico is labeled ________."

Geography
1 answer:
xxMikexx [17]3 years ago
4 0
I am pretty sure it is mT
You might be interested in
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
use the cardinal directions to describe the location of the state of Ohio in relation to its surrounding states and Lake Erie
elena55 [62]
Southeast of michigan, south of lake erie, east of indiana, west of pennsylvania, north of kentucky and west virginia
8 0
3 years ago
What is the name of the planet that has the second largest orbit
Oksana_A [137]

Answer:

kvbm

Explanation:

5 0
3 years ago
Plants obtain nitrogen from the ?
Levart [38]
From nitrogenous bacteria found on the surface of leguminous plants. They convert nitrogen into nitrates which is absorbed by plants
5 0
3 years ago
Read 2 more answers
Which of the Earth’s biomes are missing from the image above?
AnnZ [28]

Answer:

a

Explanation:

6 0
3 years ago
Other questions:
  • The most famous route through the appalachian mountains to the west was the _______.
    13·1 answer
  • The diagram below shows an undisturbed rock. A rock sample is shown with four layers marked A, B, C, D from top to bottom. Which
    5·2 answers
  • trapezoid W'X'Y'Z' is the image of trapezoid W X Y Z under a dilation through point c what scale factor was used in the dilation
    14·1 answer
  • Why is the lakshadweep islands not highly ppulated
    6·1 answer
  • What are the circular features on the moons face and how did they form
    15·2 answers
  • Can camels live in areas other than hot deserts?​
    15·1 answer
  • The sun's energy moves within the radiative zone via ____.
    10·2 answers
  • Rivers can get water from the underground water table.<br><br> Select one:<br> True<br> False
    14·1 answer
  • First let 2161965 answer<br> and then you ..
    8·1 answer
  • Guys pleasee help me like i need to turn this in really soon but im struggling​
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!