1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MAVERICK [17]
3 years ago
9

Which of these checkpoints determines if cell division has occurred properly?

Biology
1 answer:
Tomtit [17]3 years ago
8 0
<span>Cell division has two checkpoints namely, G1 checkpoint and spindle assembly checkpoint. The checkpoint which determines if division has properly occurred is the G1 checkpoint. At this point, is a damage in the DNA is detected or the has not reach the optimum size, the cell is stopped in G1 and is not allowed to proceed to further process.</span>
You might be interested in
What objects in the solar system are larger than earth
Marta_Voda [28]

Answer:

the sun, jupiter, saturn, uranus, neptune

Explanation:

6 0
3 years ago
Name five movements that are involuntary.
Reil [10]

Answer:

Five involuntary movements are- Beating of heart, Breathing, digestion, eye re-flexion, salivation.

Explanation:

Involuntary movements can be described as uncontrolled movements of the body parts on which one has no control over.

4 0
3 years ago
Which of these is not a characteristic of all living things?
Inessa [10]

Answer:

All living organisms share several key characteristics or functions: order, sensitivity or response to the environment, reproduction, growth and development, regulation, homeostasis, and energy processing. When viewed together, these characteristics serve to define life.

Explanation:

hope this helps

3 0
3 years ago
Because it is so rich in nutrients, what zone supports a huge variety of<br> organisms?
Fed [463]

Answer:

Intertidal Zone

Explanation:

I looked it up :)))

5 0
2 years ago
Selena made a chart to group adaptations in birds based on their main functions.
KATRIN_1 [288]

Answer:C

Explanation:

8 0
3 years ago
Other questions:
  • Which cellular structure is responsible for the localized storage of chromosomal dna?
    10·1 answer
  • 20. The figure below from Ch.28 shows the sequence of events in a soccer kick. Describe what is happening in each image. What ha
    9·1 answer
  • What should you do with its contents if you are done using a test tube
    11·1 answer
  • Which term best describes the water in a sugarwater solution?
    9·1 answer
  • Why are enzymes important to cells? they help bring about chemical reactions. they store large quantities of energy. they provid
    8·2 answers
  • " The molecules used to cut, copy, and connect the DNA segments used in this process are
    5·1 answer
  • Mitosis consists of four basic phases: prophase, metaphase, anaphase, and telophase. Some textbooks list five, breaking prophase
    7·1 answer
  • What was the most important development in the biological and medical sciences in the late 19th and 20th centuries based on the
    5·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • DNA and RNA are nucleic acids made up of long strands of 100's of nucleotides. What is the only difference in each nucleotide?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!