1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erastova [34]
3 years ago
6

Siberia has experienced many environmental problems because of _____.

Geography
2 answers:
irakobra [83]3 years ago
6 0
The choices can be found elsewhere and as follows:

difficulties transporting goods
fighting during World War II
privatization of industry
<span>policies during the Soviet era
</span>
I believe the correct answer is the last option. Siberia has experienced many environmental problems because of policies during the Soviet era. 
ololo11 [35]3 years ago
3 0

Another answer type would be intense industrialization policies during the Soviet era




You might be interested in
I need help on this very confusing.
Sholpan [36]
Which one are you talking about
3 0
3 years ago
What 2 rocks are formed by volcanic activity
cluponka [151]
Obsidian and pumic.
4 0
4 years ago
What are two types of weathering,and how are they different?
tigry1 [53]
One type of weathering is man made weathering. (For example) Humans may carve a rock or mine for minerals. Another type is natural weathering. This is when a river may push a rock or lighting may scratch a tree. That weathering is naturally occurring. Hope that helped!
4 0
4 years ago
Why are time zones necessary
erma4kov [3.2K]

Answer:

A time zone is a region of the Earth that has adopted the same standard time (local time).

-Most adjacent time zones are one hour apart (although a few are 30 minutes).

-They compute their local time as an offset from Greenwich mean time (GMT).

Explanation:

8 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Other questions:
  • What would happen to the earth without natural greenhouse effect​
    11·1 answer
  • What important demographic shift occurred in the 1950s? Over 50% of families moved from the East coast out west/ Black families
    10·1 answer
  • Which diagram represents a landscape where fine-grained igneous bedrock is most likely to be found?
    5·1 answer
  • An important part of the free enterprise system is the belief that _____.
    14·2 answers
  • What issues caused many people to emigrate from Nicaragua?
    11·1 answer
  • Why are there 7 continents?
    6·2 answers
  • imagine that you are going to a far away planet there is no water so you will have to take supplies what you will need​
    8·2 answers
  • Carlos is having a party in his backyard. He decides to put up a canopy from each corner of his
    14·1 answer
  • Why are aerial and satellite imagery used in mapping
    8·1 answer
  • There are. . Parts of Arab world​
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!