1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
luda_lava [24]
3 years ago
11

Tom designs bath time toys. Which modification will help him improve the performance of water squirting whales? A) Larger hole B

) Harder plastic C) Smaller whale body D) Thicker, more flexible material
Biology
2 answers:
andrey2020 [161]3 years ago
8 0

Answer:D

Explanation:

the water squirting whales should be made with a Thicker and more flexible material

irinina [24]3 years ago
7 0

Answer:

The material would be more flexible than the previous material allowing the water to squirt out more efficiently and effectively, and not to mention faster.

You might be interested in
Examples of hypothesis ​
FromTheMoon [43]

Answer:

Here are some examples of hypothesis statements:

If garlic repels fleas, then a dog that is given garlic every day will not get fleas.

Bacterial growth may be affected by moisture levels in the air.

If sugar causes cavities, then people who eat a lot of candy may be more prone to cavities.

3 0
3 years ago
Read 2 more answers
Which relatively flat feature of the ocean floor is in the open ocean and borders the continental shelf? abyssal plain mid-ocean
Dimas [21]
Lying generally between the foot of acontinental rise and a mid-ocean ridge,abyssal plains cover more than 50% of the Earth's surface. the zone of theocean floor that separates the thinoceanic crust from thick continentalcrust. ... the slope between the outer edge of the continental shelf and thedeep ocean floor.
4 0
3 years ago
Read 2 more answers
Describe the relationship between cells and organisms
Elden [556K]
Cells are the basic unit of structure and function in organisms.
Needless to say, organisms can’t be a thing if cells didn’t exist.
7 0
3 years ago
In order to prevent pest infestations it is important to.
svlad2 [7]

Answer: Take out the trash regularly, make sure food is stored in secure containers, clean the house regularly, and don't leave perishable foods out for a long time.

8 0
2 years ago
Which statement is an example of a scientific theory?​
krok68 [10]

Answer:

The big Bang theory

Theory of evolution

Germ theory of disease

3 0
3 years ago
Other questions:
  • The best place to get preliminary information on a research topic.
    5·1 answer
  • The language of science ?
    13·1 answer
  • Many farmers now grow insect-resistant varieties of cotton. The gene for the favorable trait, in this case, insect resistance, i
    9·2 answers
  • Which of the following is a true statement about hypotheses?
    9·2 answers
  • When a mother bear nurses a cub, she gives the cub what it needs for growth and development in the form of milk or food, which i
    13·1 answer
  • Think about a pond ecosystem. List 3 examples of relationships between abiotic and biotic factors in ecosystem
    15·2 answers
  • What is the main function of the organs thyroid gland, adrenal glands, and pancreas?
    5·1 answer
  • What is Classification?<br><br>Take 50 points​
    8·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • when a neurotransmitter opens a chemically gated ion channel that allows sodium to enter the postsynaptic cell, the result is an
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!