1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bad White [126]
3 years ago
15

What happens when oceanic plates spread as shown in the image above?

Biology
2 answers:
victus00 [196]3 years ago
8 0

Answer:

Hey I hope this helps: but its A if im correct

Explanation:

subduction would mean they collided so it isnt that. the sea floor will be there its just being moved apart. and obviously something happens the earth was pulled apart. hope that helps

Ad libitum [116K]3 years ago
5 0

Answer:

A I think hopefully

Explanation:

You might be interested in
I’m not the best with biology, so I’m literally just stuck on this, please someone help!
Shalnov [3]
Yes, the story surprised me very much. However, I don’t think these similarities are something the twins inherited, I think they are coincidences. You can’t inherit the same wife or other similarity that are not decided by genes.
7 0
3 years ago
The fossilized teeth of ancestors of the modern horse have grown progressively larger and flatter over the past 60 million years
ohaa [14]
Because nowadays, many horses are domesticated, and food they would have eaten in the wild, they don't usually eat anymore. They have learnt to adapt to eating other foods, like hay, that require molars to ingest. This is why over time, their tooth structure has changed.
4 0
4 years ago
Will Mark as Brainliest
Kazeer [188]

Answer:

Thymine

Explanation:

Uracil is the nitrogenous base present only in RNA, but not in DNA. ... DNA have thymine, guanine, adenine and cytosine. Thymine is replaced by uracil in RNA.

4 0
3 years ago
(PLATO) Select the correct answer.
astra-53 [7]

Answer:

A  is your answer  = )

Explanation:

cause I know

8 0
3 years ago
Five factors affecting self pollination and cross pollination. Give five for each, pls help me ASAP​
vekshin1
<h3><u>Self</u><u> </u><u>Pollina</u><u>tion</u><u>:</u></h3>
  • Bisexuality
  • Cleistogamy
  • Homogamy
  • Chasmogamy
  • Position of antlers

<h3><u>Cros</u><u>s</u><u> </u><u>Pollination</u><u>:</u></h3>
  • Dicliny
  • Self incompatibility
  • Male sterility
  • Heterostyly
  • Dichogamy

<h3><em><u>Keep</u></em><em><u> </u></em><em><u>lear</u></em><em><u>ning</u></em><em><u>.</u></em></h3><h2 />

5 0
2 years ago
Other questions:
  • The epidermis consists of five layers of cells, each layer with a distinct role to play in the health, well-being, and functionin
    10·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • The recycling truck comes every Friday to gather what has been put into the trash cans. This is similar to _______ in eukaryotic
    12·2 answers
  • What causes fingers to look wrinkled after soaking in water?
    7·2 answers
  • Please help be quick and correct 5
    8·1 answer
  • Explain why ecological succession occurs.
    9·1 answer
  • True or False:
    5·2 answers
  • This investment is best considered high risk with the potential for a low return. high risk with the potential for a high return
    15·2 answers
  • What question did Jan Ingenhousz seek to answer about plants?
    14·1 answer
  • Strep throat and bacterial pneumonia are examples of __________.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!