1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Keith_Richards [23]
3 years ago
5

Explain how thing that plants or animals do are done by the work of cells?

Biology
1 answer:
GaryK [48]3 years ago
8 0
Photosynthesis? I think this is right
You might be interested in
What will happen if the cilia cleared the mucus? ​
Marrrta [24]

Answer:

You sneeze

Explanation:

I think so, when the cilia clears the germs you sneeze

5 0
3 years ago
1 Explain why animals depend on plants to keep them alive.
Gnoma [55]

1. Animals depend on plants to keep them alive is Plants are producers  they take energy from the sun, nutrients from the earth, and water to grow and have their flowers, seeds, and berries.

They also release oxygen, which all animals, including humans, need to stay. Animals are consumers and they all depend on plants for survival.

2. carbon dioxide and water reach the chloroplasts in leaves is Basically the roots consume the water and transports it up the xylem, which gets it to the leaves. Carbon dioxide contacts the chloroplasts in the leaves via a stomata

3. Two pieces of evidence that show that plants cannot make their own food without light. When plants lack light, they don't deliver chlorophyll (the green pigment in plants), and plants can turn pale green to yellow to white. Plant stems become “leggy,” meaning stems become long and thin and appear to be advancing toward the source of light.

  • The photosynthesis is the only method for synthesizing food. It is commonly believed that about 717.6Kcal energy is required to prepare just 10g of glucose. No energy input no metabolism and therefore no food.

<h3>How are leaves tested for starch?</h3>

The existence of starch in leaves can be tested by the Iodine test. When we remove chlorophyll from the leaf by cooking it in alcohol and then placing two drops of iodine solution, it is a color change to blue indicates the existence of starch.

To learn more about  producers, refer

brainly.com/question/8806324

#SPJ9

7 0
1 year ago
Describe relationship between cytoplasm and nucleus in a cell
Anika [276]
"The nucleus contains the cell's DNA. This genetic material provides the instructions for building proteins and, thus, dictates the structure and function of the cell throughout its life. ... In some types of cells, cytoplasm is also used to move the cell itself or to move organelles within the cell."( I found this in an article on google)
8 0
3 years ago
Read 2 more answers
Why is there stuff? this is a science question?
Elena L [17]

This is a strange way of asking a question but "stuff" is  made up of things called atoms. EVERYTHING is made up of atoms. In solids, the atoms are tightly compacted together. In liquids, the atoms are sort of close together but move freely. In gasses, the atoms are very spread out. I hope this answers your question, I can't really think of much else to say about this... :D

5 0
3 years ago
Read 2 more answers
HELP ME POR FAVOR WILL GIVE BRAINLIEST AND YOU GET 25 POINTS, WHAT A STEALLLL.. ok
S_A_V [24]

Answer:

DNA base triplets → amino acid sequence → protein folding pattern → protein shape and function

Explanation:

From Google:

"The Rules of Protein Structure. The function of a protein is determined by its shape. The shape of a protein is determined by its primary structure (sequence of amino acids). The sequence of amino acids in a protein is determined by the sequence of nucleotides [base triplet] in the gene (DNA) encoding it."

4 0
3 years ago
Other questions:
  • As food molecules are broken down during __________, carbon is released back into the atmosphere as carbon dioxide.
    11·1 answer
  • Some animals in grasslands can obtain water they need from plants. true or false.
    11·2 answers
  • Which is a point mutation?
    11·1 answer
  • Water and minerals move from the roots to the leaves via
    11·2 answers
  • Different versions of a federal bill have successfully passed both in the House and the Senate. Which is the next step in the la
    8·2 answers
  • Which of the following is true about DNA mutation
    13·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • What is friction А a force that slows an object down B a force that speeds an object up ca force that makes an object start movi
    6·1 answer
  • I need help asap please!!
    5·1 answer
  • ‼️‼️‼️<br> PLEASE HELP WILL GIVE BRIANLIEST :))
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!