1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ycow [4]
3 years ago
15

Why is energy another name for photosynthesis?

Biology
1 answer:
Dmitry_Shevchenko [17]3 years ago
3 0
Because plants use energy from the sun to make food
You might be interested in
_____ is the process by which the information from mRNA is coded for amino acids
Lilit [14]
Transcription is the answer you are looking for
7 0
3 years ago
Read 2 more answers
In the image below which letters represent facilitated diffusion?
kykrilka [37]

Answer:

A, B, C

Explanation:

One is a channel, one is a carrier, the other is simple

6 0
3 years ago
Help I'm confused!
aev [14]

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

7 0
3 years ago
Coal is considered a nonrenewable resource.<br><br>A) TRUE<br><br>B) FALSE
notka56 [123]

Answer:

true

Explanation:

Coal is a non-renewable energy source because it takes millions of years to form.

5 0
4 years ago
What are two fungi skin infections that humans can contract
Kipish [7]
Candidiasis Infection and aspergillosis Infection

hope this helps if not just let me know
4 0
3 years ago
Other questions:
  • Students who study perform better in school. What is the hypothesis
    6·1 answer
  • Please select the word from the list that best fits the definition<br><br> broadcasting
    14·2 answers
  • Which are units used to express volume
    7·1 answer
  • This is the study of biological inheritance.
    5·2 answers
  • A environment in which an organism's needs are met.
    11·2 answers
  • What appropriate percentages of land have been used for housing and pasture areas?
    11·1 answer
  • In your body, homeostasis is maintained when_____________ feedback happens when a particular threshold is reached, and the respo
    14·1 answer
  • The purpose of the study described in the passage was: A.to determine whether LH can modulate GnRH or NPY secretion. B.to determ
    11·1 answer
  • A large protein needs to enter a cell to help preform a function explain what process the cell must use to allow the protein to
    14·1 answer
  • What is the function of the phloem? Select one: Phloem carries water and minerals to the rest of the plant from the roots. Phloe
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!