1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iren [92.7K]
3 years ago
10

Suppose a geneticist isolates two bacteriophage mutants. One mutation causes clear plaques (c), and the other produces minute pl

aques (m). Previous mapping experiments have established that the genes responsible for these two mutations are 8 m.u. apart. The geneticist mixes phages with genotype c+ m− and genotype c− m+ and uses the mixture to infect bacterial cells. The geneticist collects the progeny phages, cultures a sample of them on plated bacteria, and observes 1000 total plaques. What numbers in the different types of plaques (c+m+, c-m-, c+m-, c-m+) should she expect to see?
Biology
1 answer:
Nesterboy [21]3 years ago
5 0

Answer:

The mentioned parental types are c+m- and c-m+. Thus, the recombinants will be c+m+ and c-m-.  

Now, the given distance between c and m is 8 map units. Thus, the recombinant frequency is 8% or 0.08.  

The total recombinants from 1000 plaques will come out to be 80,  

Thus, the recombinants of each type will be 40.  

Total parental type will be 920, and therefore, each parental type count will be 460.  

Thus, expected c+m- = 460, expected c-m+ = 460, expected c+m+ = 40 and expected c-m- = 40.

You might be interested in
Does anyone know how to answer this question? Please
Sergio [31]

Basically the question is asking you, out of these statements:

A) Meiosis results in four haploid daughter cells

B) Meiosis results in four diploid daughter cells

C) In both processes, DNA replication must occur

D) During meiosis the 2N mother cells produces N daughter cells

E) Mitosis is responsible for genetic continuity, in higher organisms it is essential for growth and repair

which one(s) are true. They provide you information (Venn diagram as well as paragraph) to help you solve this question.

The information tells us what's the correct answers.

Say for an example, the venn diagram tells us that unlike mitosis, during the process of meiosis the 2N mother cells produces N daughter cells (hence why you see the equation 2N ---> N only in meiosis' circle instead of in the middle [which signifies that both mitosis and meiosis shares this trait] or on mitosis' side [which signifies that only mitosis has this trait].) Therefore, D - or the fourth - answer choice is correct, so identify it as a true statement.

A - or the first answer choice - is correct as well. B - or the second answer choice - is not so do not identify it as true. In the paragraph it tells us that instead of two identical daughter cells with the same chromosome number (which is a diploid cell) and DNA, four daughter cells are produced with half the chromosome number, which is a haploid (think of half when you see haploid).

C - or the third answer choice - is right. In the paragraph is states that both processes have DNA replication take place. For mitosis it states "The parent cell goes through DNA replication(...)". For meiosis it states "(...) DNA replication still takes place (...)".

E - or the last answer choice - is correct. In the venn disgram, it has growth and repair under mitosis and the paragraph states that for mitosis, simple organisms use this process as a method of asexual production (which, by the way, maintains genetic continuity).

So, here's our recap:

A is a true statement. Identity it as true.

B is NOT correct thus do <em><u>not </u></em>identify it as true.

C is a true statement. Identify it as true.

D is true thus identify it as such.

E is too true. So, identify it.

Ways to identify includes and is not limited to:

* circling

* highlighting

* selecting

* writing T or true by what's true

* underlining the true statements

* checking the true statements with a check mark

You can signify B as untrue by writing F or false by it, crossing it out, putting an x by it, or simply leaving it be. It all depends on what you're able to do.

3 0
4 years ago
How did the results prove the semiconservative model of DNA<br> replication? Explain.
MA_775_DIABLO [31]

Answer  and  Explanation:

Image result for How did the results prove the semiconservative model of DNA

The experiment done by Meselson and Stahl demonstrated that DNA replicated semi-conservatively, meaning that each strand in a DNA molecule serves as a template for synthesis of a new, complementary strand. Although Meselson and Stahl did their experiments in the bacterium E.

4 0
2 years ago
A heterozygous blue-nose pit bull breeds with another blue nosed pit bull. Their
mina [271]

Answer:

Bb and bb

Explanation:

one parent might be a carrier of the black-nose gene and the other parent is not OR both parents can be carriers of the black-nose gene.

7 0
4 years ago
How much chemical energy (stored as biomass) is available to primary consumers from 10,000 kcal of primary productivity?
atroni [7]
The answer is “d” (1,000 kcal). As the trophic level increases energy is decreases by 10 times that of the previous level. If a system has 10,000 kcal, then the primary consumer have 10 times less (10,000/10) which is 1,000 kcal. The secondary consumers have 100 kcal and the tertiary have 10 kcal. Only 10% of the energy at each trophic level goes on to the next.
7 0
3 years ago
The structure of aba is shown below. why was this a suitable substitution for a cys residue? under what circumstances would it n
Inessa [10]

Answer and explanation;

-Aba is a suitable replacement because Aba and Cys have approximately the same sized side chain and are similarly hydrophobic.

-However, Aba cannot form disulfide bonds so it will not be a suitable replacement if these are required.

-Alpha-Aminobutyric acid is biosynthesized by transaminating oxobutyrate, a metabolite in isoleucine biosynthesis.


8 0
3 years ago
Other questions:
  • Urgent please and thank you
    9·1 answer
  • ·supports and protects ·
    11·2 answers
  • Please help and don’t guess PLEASE HELP ME ASAD NEED HELP ALT OF POINTS AND LIKES AND ANYTHING BUT DONT GUESS PLEASE HELP ME
    11·1 answer
  • What are decomposers?
    9·1 answer
  • The neurotransmitter associated with bulimia nervosa is ______________.
    14·2 answers
  • Macromolecules are mainly around which element?plss help
    13·1 answer
  • Which solution would mostly likely cause a plant placed in it to become firmer and more rigid
    8·1 answer
  • Which two factors often determine the type of rock that is formed by a
    9·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • In your own words summarizing the reasons people left their home countries to start new lives in the United States
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!