1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
-BARSIC- [3]
3 years ago
8

Almost all plant cells have the ability to produce abscisic acid. One of the functions of abscisic acid in plants is to Almost a

ll plant cells have the ability to produce abscisic acid. One of the functions of abscisic acid in plants is to delay leaf senescence. promote stomatal closure during drought stress. regulate development of fruit. stimulate cell elongation.
Biology
1 answer:
kondaur [170]3 years ago
4 0

Answer:

promote stomatal closure during drought stress.

Explanation:

Abscisic acid inhibits the growth and stomatal opening, specifically when the plants are exposed to some stress conditions. Abscisic acid also regulates the seed maturation and seed dormancy. ABA concentration in leaves increases multiple folds under drought conditions. Its accumulation in leaves promotes closure of stomata and prevents the water loss by transpiration. ABA is required to restore the turgor pressure under drought conditions by stimulation of stomatal closure.

You might be interested in
Kinases such as pyruvate kinase or hexokinase transfer?
igor_vitrenko [27]
What are you writing write full
4 0
3 years ago
Which of the following lists the reactants (raw materials) needed for photosynthesis to occur? *
Evgen [1.6K]

Answer:

carbon dioxide and water

Explanation:

carbon dioxide and water are the raw materials needed to start the reaction. They are on the left side of the equation so that is how you know.  

5 0
3 years ago
Read 2 more answers
Two European men and two Polynesian women settled on a previously uninhabited tropical island. All four of the settlers have bro
kati45 [8]

Answer:

Two European men and two Polynesian women settled on a previously uninhabited tropical island. All four of the settlers have brown eyes, a dominant trait, but one of the Europeans is heterozygous and carries the recessive gene for blue eyes.  No new settlers arrive,and nobody leaves the island.After a few generations,the percentage of blue-eyed individuals increases from the original zero to 25 percent.This is probably due to which of the following factors?

genetic drift

Explanation:

Genetic drift entails when there are changes in the gene frequency which occur in a gene that is existing. From the analogy above, it is a known fact that only gneetic drift could allow such to happen as mutation will only occur with a sudden change of gene which is not the case described above

3 0
2 years ago
Wirte 2 slogans on 'need to conserve nature? ​
natima [27]

Answer:

Tree planting is the safest solution to pollution. Save the earth, save our environment. Don't be cruel, conserve your fuel.

5 0
2 years ago
Read 2 more answers
How high doses of radiation could affect a person's ability to make blood
34kurt
Radiation can actually affect the entire body, however it has a large effect of the bone marrow. Radiation is dangerous because too much can cause cellular depredation, this happens in environment that rapidly change like the bone marrow, which then interferes with blood cell production.
8 0
3 years ago
Other questions:
  • Specialized proteins that act as catalysts for chemical reactions are _____.
    9·1 answer
  • Why is water conservation important?
    15·1 answer
  • How do the circulatory and respiratory systems work together for gas exchange?
    13·2 answers
  • Am I correct on the questions above?
    9·1 answer
  • The diagram reveals that lipids and proteins are both parts of cell membranes.They have different functions because lipids work
    12·2 answers
  • If this fossil is 65 million years old, what could this fossil suggest about organisms alive today?
    10·2 answers
  • Which statement accurately describes the inner planets?
    12·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • E
    9·2 answers
  • Please help with d and explain
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!