The answer is cytoplasm
cytoplasm is a gel in the cell and contains the cells organelles :)))
i hope this is helpful
have a nice day
Bulimia Nervosa is the disorder where a person will eat excess amounts and then purge.
Answer:
the phase that describes a plant spore but not the plant seed is called meiosis
He will let CO2 out also when he poops he lets out CO2 too.
Answer for this question will be
3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand will be 5'UACGGGCCCACAGCAUAACU 3'
