1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
anyanavicka [17]
3 years ago
10

Why do we need greenhouse gases in our air?

Biology
1 answer:
Law Incorporation [45]3 years ago
7 0

Greenhouse gases such as carbon dioxide trap heat, helping warm the globe. The surge in carbon dioxide levels due to human activity since the Industrial Revolution is now causing an overall warming of the planet that is having impacts around the globe. And the burning of fuel generates not only carbon dioxide, but also air pollutants that are harmful to human health.

You might be interested in
How are ice caps formed?
Eva8 [605]
Ice caps form because high-latitude regions receive less energy in the form of solar radiation from the Sun than equatorial regions, resulting in lower surface temperatures.

# eazy
4 0
3 years ago
If you cross a mule and a horse, you get a donkey. How many chromosomes does a donkey have?
madreJ [45]

Answer:

62

Explanation:

31 pairs

A mule is the offspring of a male donkey (a jack) and a female horse (a mare). A horse has 64 chromosomes, and a donkey has 62. The mule ends up with 63. Mules can be either male or female, but, because of the odd number of chromosomes, they can't reproduce.

3 0
3 years ago
The process of ____________ increases genetic variability as it produces gametes for sexual reproduction. A) conjugation B) meio
LekaFEV [45]
B) Meiosis-"a type of cell division that results in four daughter cells each with half the number of chromosomes of the parent cell, as in the production of gametes and plant spores." taken from google
7 0
3 years ago
Read 2 more answers
Geneticists can transfer a gene from a DNA of one organism into another through a process called ...............................
77julia77 [94]

Answer:

The answer is B.

Explanation:

Genetic engineering involve the change of genetic material of an organism by removing, changing or inserting individual genes.

5 0
2 years ago
.What does a reviewer do during peer-review?
Gnesinka [82]
They check for mistakes and bias
4 0
3 years ago
Read 2 more answers
Other questions:
  • What could be the possible result of founder effect on genetic variation
    7·1 answer
  • When density increases, the number of molecules in a volume___
    10·2 answers
  • During expiration, the volume of the thorax __________ as the diaphragm __________
    15·1 answer
  • What are the 4 differences between eukaryotic/ prokaryotic
    15·2 answers
  • Cells are the basic units of llfe. Viruses differ from cells in many key ways. Which of the
    12·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • The belief that all life came about through natural processes, mutation, and natural selection.
    15·2 answers
  • Who invented Napiers bone and when <br><br>​
    11·2 answers
  • Rose plant can reproduce by just cutting one of its long stems and stick it to the soil. This is a best example of what type of
    15·1 answer
  • A____is a musculoskeleteal injury in which there is a partiral or temporay seperation of the bone ends as well as partial tretdh
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!