1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
a_sh-v [17]
3 years ago
5

Triple X syndrome, or trisomy X, occurs when a female has an extra X chromosome in each of her cells. This results when the moth

er's reproductive cells divide improperly, and two X chromosome are moved into one gamete. When that gamete is fertilized and the father's DNA and X chromosome are combined with the mother's, that gives the cell three X chromosomes instead of two. Triple X syndrome occurs because of...
A) Crossing over
B) Nondisjunctions
C) Point mutations
D) Deletions
Biology
2 answers:
almond37 [142]3 years ago
6 0

Answer: B) Nondisjunction.

Explanation: Syndromes such as triple X syndrome, Turner's syndrome, Down syndrome, and Klinefelter's syndrome occur because of nondisjunction, or the improper separation of the chromosomes during division. In each of these cases, an extra chromosome (X chromosome for triple X, chromosome 21 for Down syndrome, etc.) causes symptoms in the offspring. In some syndromes, such as triple X syndrome, the symptoms are often not very noticeable.

Kisachek [45]3 years ago
5 0
The answer is b, non-disjunction
You might be interested in
For anyone who answers ill give points!
Sergeeva-Olga [200]

Answer:

B

Explanation:

facilitated diffusion requires an ATP, which means it DOES take up energy

8 0
2 years ago
True or False: The environment is changing the genotype(genetic makeup) of the rabbit?
lisabon 2012 [21]
The answer is false explanation: while environment may slowly cause evolution it doesn’t change the overall genetic make up
6 0
3 years ago
Read 2 more answers
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
What most likely led directly to the appearance of reptiles during the Carboniferous Period?
Vikentia [17]
<span>what really led into that was most likely the evolution period, all of the reptiles were subdivided into noticeable stages

</span>
3 0
3 years ago
Read 2 more answers
How would a government most likely respond to a slowdown in the economy?
Crank
B. Lowering taxes in order to stimulate spending. When the economy experiences a downturn, the government is more likely to cut taxes to allow price competitiveness of goods, thereby triggering demand, hence consumption among households. A boost in consumption should translate into an increase in supply that wwould in turn bring about job creation. The negative trend would therefore be reversed.
5 0
4 years ago
Read 2 more answers
Other questions:
  • What must be true about the concept of evolution​
    6·1 answer
  • Whatwithout sinking which property of water allows the paper clip to float? A. Ph B. Capillary action c. High specific heat D. S
    8·2 answers
  • An example of a xerophyte would be _____.
    14·2 answers
  • Which of these would BEST describe the structural difference between magnesium and aluminum?
    9·2 answers
  • Which of the following describes why ice floats?
    15·1 answer
  • Yaniyah is a cross country runner. She runs up a lot of hills. Some hills are very steep and some are much flatter. The steepnes
    8·1 answer
  • Why is gasoline organic
    14·2 answers
  • Can you please help me
    12·2 answers
  • Help with my homework plz
    11·1 answer
  • Explain how a mutation could have no effect on the organism that inherits the mutation
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!