Answer: Homologous chromosomes are randomly distributed to daughter cells, this means different chromosomes segregate independently of each other. And they exchange segments of DNA during crossing over. This recombination creates genetic diversity because genes from each parent are exchanged.

Explanation:

Meiosis is a type of cell division that produces gamete cells, which are sex cells (egg and sperm)

Chromosomes that form a pair and are found together are called homologous chromosomes, and they are inherited from each parent. During prophase of meiosis I, the homologous chromosomes exchange segments of DNA in a process called crossing over. This recombination creates genetic diversity because genes from each parent are exchanged. <u>It results in new combinations of genes on each chromosome.</u>

After that, during the anaphase of meiosis I, the two chromosomes line up on the equatorial plane of the cell. Then, they are separated and each will go to a new daughter cell. So homologous chromosomes are randomly distributed to daughter cells, <u>this means different chromosomes segregate independently of each other.</u>

3 0

2 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein