Fungi because bacteria, eubacteria could also but fungi is most likely to
Males have a X and Y chromosome while females have 2X chromosomes. So a Y linked gene will not be able to be passed on to females, only to males and all males will have the dominant gene and expressing the phenotype. Whereas for X linked gene, females can be recessive or dominant for that gene Xa, XA thus may or may not have the phenotype whereas once males inherit the dominant XA allele, they will express the phenotype as males only have one X chromosome. Hope I helped!
3- TACGGATGTACACCACATTGGAA -5
Answer:
staphylococci
Explanation:
Gram stain -
it is the method of staining which classify the species of the bacteria into gram - positive and gram - negative .
This method distinguish the bacteria by its physical and chemical properties of the cell well of the bacteria .
1. In case of gram - positive , the stain is of color violet , because to its thick cell wall .
and ,
2. In case of gram - negative , the stain is of pink color , because to thinner cell wall .
The bacterium , which shows Gram - positive coccus after the gram stain is staphylococci .
The energy from the light excites an electron from its ground energy level to an excited energy level.