1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liraira [26]
3 years ago
14

When 2 organisms donate half of their genetic material to make one new genetically unique organism. What is this called?

Biology
1 answer:
just olya [345]3 years ago
5 0
It is called genetic enginering
You might be interested in
Predict how a lack of resources (food, water, shelter) would influence population size. Do you think the lack of availability wo
KonstantinChe [14]

Answer:

a lack of resources would most likely decrease a population size because it will limit growth and decrease survival rates. There will also be more competition.

Explanation:

Please don't plagiarize. Thanks :)

4 0
3 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
A substance that causes pigment particles to adhere to one another and attach to the surface of a painting is known as a _______
BlackZzzverrR [31]

A substance that causes pigment particles to adhere (stick) to one another and remain attached to the surface of a painting is called a: binder.

<h3>What is painting?</h3>

Painting can be defined as a process that involves coating the surface of an object or body, especially through the application of a paint.

In painting, color is most notably and primarily provided by pigment.

<h3>What is a binder?</h3>

A binder can be defined as a substance that causes pigment particles to adhere (stick) to one another and remain attached to the surface of a painting.

In conclusion, a binder is a substance that makes it possible for pigment particles to stick completely together to one another and remain attached to the surface of a painting.

Read more on painting here: brainly.com/question/17996239

3 0
3 years ago
Which one of the following statements about secreted proteins is incorrect? Secreted proteins: are likely to have received N-lin
Fiesta28 [93]

Answer:

they travel directly from the rough endoplasmic reticulum into the trans face of the golgi apparatus

4 0
3 years ago
QUICKKKKKK PLEASE HELP!!
den301095 [7]

Answer:

hi

Explanation:

photo

7 0
2 years ago
Read 2 more answers
Other questions:
  • Describe how scients and bioligist study the world
    9·1 answer
  • What is not a a form of passive transport
    5·1 answer
  • What is heterotroph that consumes the carcasses of
    6·1 answer
  • Imagine you were the manager of a national park with cheetahs. The cheetahs feed primarily on gazelles while the gazelles eat gr
    9·1 answer
  • Which function of the muscular system is best illustrated by the heart pumping blood throughout the body?
    13·2 answers
  • uit flies are commonly used in genetic investigations that focus on traits passed from parents to offspring over several generat
    12·1 answer
  • Experiments with isotopes used as tracers showed that some fungi _____. A. help plants get nutrients in exchange for sugar B. ta
    14·1 answer
  • What term is used to describe bacterial cells that can naturally take up dna from their environment?
    12·1 answer
  • What conditions make for a violent volcanic eruption?
    6·2 answers
  • If plaque buildup reduces the radius of the artery by a factor of 2, by what factor does the flow rate change?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!