1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fomenos
2 years ago
15

A human cell containing 22 autosomes and a Y chromosome is

Biology
1 answer:
murzikaleks [220]2 years ago
8 0

The correct answer is A. A sperm

Explanation:

Sperms are a type of reproductive cells that are essential for sexual reproduction. Sperms are male reproductive cells different from eggs that are female cells. Additionally, these can have flagella that allow them to move to reach the egg or be non-motile. In the case of human sperms, these have a flagella and also they contain 23 chromosomes; additionally, in this there is 1 allosome chromosome that defines sex and in males and therefore sperms can be either X or and 22 autosomes that refer to chromosomes not related to sex, this is also particular from sperms as eggs in humans can only have an X allosome. According to this, it is a sperm the cell that contains 22 autosomes and a Y chromosome.

You might be interested in
Glass windows allow light in, but trap the heat inside. This describes _____.
eimsori [14]
Your answer is A) - a greenhouse effect

that happens also at large scale, when the atmosphere is playing the role of the windows and the climate on earth became warmer. 
4 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Do animals and humans have the same immune system and cite sources
stira [4]

Answer:So yes,humans and other mammals (like dogs) have same immune system. Differences may occur in the protein structures, but they all come in same family and work similarly like humans.

Explanation: Are animal immune systems different from humans? - Quora

https://www.quora.com/Are-animal-immune-systems-different-from-humans

8 0
3 years ago
A skull with a long snout and large nose cavity could mean
Nadya [2.5K]

Answer:

emurs, aye-ayes, lorises, and galagos

Explanation:

4 0
2 years ago
The supporting structure of the cell that is also involved in movement​
Strike441 [17]

The supporting structure of the cell that is also involved in movement is most likely the cytoskeleton.

8 0
3 years ago
Other questions:
  • 2. Why do experiments need to have multiple trials?
    6·2 answers
  • Which example best represents the adhesion, cohesion, and surface tension of water?
    6·2 answers
  • Throughout human history, people have always consumed the milk of other animals
    14·2 answers
  • What system is responsible for controlling, correlating, and regulating other body systems
    15·1 answer
  • [QUIZ]Lvl 1<br><br> Is it true that all living things are made up of two or more cells
    10·2 answers
  • Hydrogen has three isotopes 1H, 2H, and 3H. What is the difference between these three isotopes?
    9·2 answers
  • All of the bones in your body, with the exception of the hyoid joint in the neck, form a joint with another bone. State True or
    7·2 answers
  • Need help with 2c. Describe what would happen over time to a tree sapling that could grow only taller not wider.
    9·1 answer
  • Which organelle is not found in plant cells?
    9·2 answers
  • There is a species of frog on an island that puzzles scientists. The proportion of frogs with no stripes is greater than the pro
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!