<span>Yes, the elite athlete gives higher readings when compared to the non elite athletes in the anaerobic activities. Anaerobic metabolism is the process of giving energy to the athletes by burning the carbohydrates without any oxygen presence. This energy helps them to give elite performances.</span>
Your answer would be D. Carbon monoxide. Everything else pollutes the water
Answer:
Explanation:
The natural particle sources include volcanoes, forest fires, ocean spray, biologic sources and the anthropogenic sources of particles are transportation, fuel combustion in stationary sources, a variety of industrial processes, solid waste disposal and miscellaneous sources such as agricultural activities and fugitive ...
Set up the equation.
Since gravity and liquid densities are fixed (for the most part), the height of the liquid is the largest variable in the equation. The equation reads as Pfluid = ρgh, where ρ is the density of the liquid, g is the acceleration of gravity, and h is the height of the liquid (or depth of the fluid)
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
