1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena-2011 [213]
3 years ago
9

Match each kind of scientist with an aspect of the hot spring she or he might

Biology
1 answer:
Ahat [919]3 years ago
3 0

Answer:

Microbiologist: Bacteria living in the hot spring

Anthropologist: Humans living nearby and using the hot spring

Botanist: Plants living around the hot spring

Zoologist: Animals living nearby and using the hot spring

Explanation:

These careers are professions that mainly study biological life. However, anthropology spans wider than biology because it mainly deals with human behavior hence will include aspects such as psychology into it.

Some other careers in biology include;

  • geneticist: studies genetics of organisms
  • bio-statistician: studies statistics within the biological realm
  • ecologist: studies ecological systems

You might be interested in
What are the effects of global warming on the earth over time?
olganol [36]
Effects that scientists had predicted in the past would result from global climate change are now occurring: loss of sea ice, accelerated sea level rise and longer, more intense heat waves.
5 0
3 years ago
In seals, brown hair (b) is dominant to white (b). a brown seal is mated white a white seal. they produce 6 brown seals. the bro
Zolol [24]
Since brown is the dominant color the children would be brown .
3 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Imagine that there is a mutation in the cyclin gene such that its gene product is nonfunctional. What kind of effect would this
Daniel [21]

Answer:

The correct answer is - The cell would be unable to produce.

Explanation:

Cyclin is a protein that helps in cell division to complete the various stages. It has an essential function, however, cyclin does not play role in enzymatic reactions bit bind with cyclin-dependent kinase enzyme they form maturation promoting factors which can phosphorylate specific proteins and result in many different stages of the cell cycle.

Mutation in cyclin gene that did not allow to produce cyclin protein will cease the cell cycle and there would be no future daughter cell and the cell would not be able to produce.

5 0
3 years ago
What can be said about prokaryotes and eukaroytes?
Murrr4er [49]
Eukaryotes always have a cell membrane, but prokaryotes don't. Eukaryotic and Prokaryotic cells are both building blocks of life in different organisms. The main difference of two is in its structures. Eukaryotic cells contain organelles that are found inside membranes, like the nucleus, which stores chromosomes and DNA. Prokaryotic cells don't have a nucleus and no true chromosomes. Prokaryotic cells are unicellular while eukaryotes are multicellular. The presence of mitochondria, chloroplasts, and cell wall are all distinct to Eukaryotic cells. Eukaryotic cells are found in animals and plants, while bacteria and archaea have prokaryotic cells.<span>  

<span>In terms of existence, prokaryotes have been on Earth for millions of years; while eukrayotic cells have come to existence through the process of evolution.  </span></span>
4 0
3 years ago
Other questions:
  • This is a chemical bond that forms between the carboxyl group of one amino acid and the amino group of the adjacent amino acid d
    13·2 answers
  • How does the digestive system work with the respiratory systrem, muscular system, urinary system, and cardiovascular system work
    13·1 answer
  • Classify the following organisms into their respective kingdoms (i) Yeast (ii) Penicillium (iii) Rhizobium (iv) Mushroom (v) Amo
    10·1 answer
  • Suppose that the farmer is growing rice crop. If he bought 5 kg seeds at Rs. 100 per kilogram, then how much net money will he g
    7·1 answer
  • Why are muscle cells also called muscle fibers?
    15·1 answer
  • Describe what a neutral atom is
    10·1 answer
  • When chromosomes do not separate you end up with a
    12·1 answer
  • Why are people dum
    5·1 answer
  • How do molecules move away from the location of a chemical reaction?
    15·1 answer
  • What are the four types of motion?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!