I think Acetic acid will be produced if wine is aerated and inoculated with bacteria of the genera acetobacter and gluconobacter. Acetobacter is a genus of acetic acid bacteria. This bacteria is used for the mass production of Acetic Acid, the main component in vinegar. Gluconobacter is also a genus of the acetic acid bacteria family.
Answer:
Hey bud the answer is A :) hope i could help
Explanation:
The primary hormone that the thyroid gland releases into the bloodstream is thyroxine. It is the inactive form, and organs like the liver and kidneys convert the majority of it into the active form triiodothyronine.
The body's metabolism, cardiac and digestive processes, muscle control, brain growth, and bone maintenance are all significantly regulated by thyroid hormones.
Hypothyroidism refers to the thyroid gland producing too little thyroxine. It could be brought on by autoimmune conditions, inadequate iodine consumption, or the use of specific medications. Sometimes there is no known cause. Untreated throxine before birth or during infancy can result in mental disability and stunted growth because thyroid hormones are crucial for both physical and mental development.
Adult hypothyroidism results in a slower metabolism. It may cause symptoms like weariness, a diminished ability to tolerate cold conditions, a low heart rate, weight gain, decreased appetite, impaired memory, sadness, muscle stiffness, and decreased fertility. For further details, read the article on hypothyroidism.
To learn more about thyroxine, refer: brainly.com/question/15557539
#SPJ4
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
The term aerobic exercise describes any type of exercise typically performed at moderate levels of intensity for extended periods of time that increases the heart rate. In such exercise, oxygen is used to "burn" fats and glucose in order to produce energy in the form of ATP, the basic energy carrier for all cells. Initially, glycogen is broken down to produce glucose, but in its absence, fat metabolism is initiated instead. Aerobic exercise is an exercise performed at a moderately high level of intensity over a long period of time. For example, running a long distance at a moderate pace.
