1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LenaWriter [7]
3 years ago
8

An object was measured by a worker as

Biology
1 answer:
tensa zangetsu [6.8K]3 years ago
4 0

Answer:

2.5271%

Explanation:

The percent error is defined as;

(error/actual value) * 100%

In this case the error will be;

27.7cm - 27.0cm = 0.7cm

The actual value is 27.7cm since it is the one specified by the manufacturer.

The percent error in the worker's measurement is thus;

(0.7cm/27.7cm) * 100 = 2.5271%

You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Are you inferring when you interpret what you have observed?
-Dominant- [34]

I don’t think so because when you are observing you refer to facts but when you infer you have to hypothesize what the outcome will be

3 0
3 years ago
Which of the following pairings of phylum and description is incorrect? A Echinodermata—bilateral symmetry as a larva, coelomate
Flura [38]

Answer:

Porifera—gastrovascular cavity, coelomate.

Explanation:

Sponges do not contain digestive system but obtain nutrients through the diffusion process. Porifera is the most commonly asymmetrical in nature but can also have radial symmetry. Porifera has no coelom.

Lacking a true digestive system, they depend on the intracellular digestive processes of their choanocytes for their energy intake. Gas exchange, circulation, and excretion occur by diffusion between the water and the cells.

6 0
3 years ago
What are the kingdoms of the eukarota domain??
masha68 [24]
The kingdoms<span> in the </span>domain Eukarya<span> are the following:

1.) Protista
2.) Fungi
3.) Plantae
4.) Animalia.

Hope this helps!</span>
7 0
3 years ago
A virus adapts to the new surrounding by manufacturing proteins when it needs them
Assoli18 [71]

Answer:

True

Explanation:

7 0
2 years ago
Read 2 more answers
Other questions:
  • Which is more numerous,the amount of microbes or the amount of people
    5·2 answers
  • Which of these is the lowest subgroup<br> A. Kingdom<br> B. Genus<br> C. Species<br> D. Order
    11·2 answers
  • The human gene egfr located onn chroosme 7 is a proto-oncogene that codes for a growth factor cell surface receptor
    9·1 answer
  • How are monotremes different from other groups of mammals?
    8·1 answer
  • Which of the following is true about cell membranes and cell walls? A. Cell wall is rigid, cell membrane supports the structure
    13·1 answer
  • The difference between theory and law
    9·1 answer
  • I will give you 20 points if someone can help me with these answers please!!!!!
    10·2 answers
  • NEED HELP!!!!! Brainliest to whoever helps the most
    7·1 answer
  • Identify the main structures of a plant.<br><br> A <br> B <br> C
    14·2 answers
  • If the economy is too big, does it have a negative or positve effect on the environment?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!