DNA is verry important to life. It is the instructions or the blueprints of how to make (and makes up) the organism. Without it life as we know it is just not possible.
Answer:
because they adapt and change by learning new behavioral traits and develop new physical traits
Explanation:
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:
To my Knowledge and understanding, the name of fluid A is oxygenated Blood or u could simply submit blood. Fluid A does contain red blood cells, namely Hemoglobin. I am not quite sure what fluid B is, but visually it looks like the cytoplasm surrounding cells. According to my knowledge cytoplasm does not contain red blood cells, but rather it contains glucose,sugars and proteins etc.
Hope this helps!
Kind regards
Farah Syed
Explanation:
/-
