1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MrRa [10]
3 years ago
14

The idea that energy cannot be created or destroyed

Biology
1 answer:
ASHA 777 [7]3 years ago
7 0
The idea that energy cannot be created or destroyed is known as "Law of Conservation of Energy" proposed by <span>Gottfried Leibniz.

Hope this helps!</span>
You might be interested in
In eukaryotes, where do transcription regulators bind?
Liula [17]

Answer:

8012088061

Explanation:

6 0
2 years ago
The processing of mRNA into a protein strand is known as?
egoroff_w [7]
It should be translation. 
6 0
3 years ago
Dark adaptation ________.
lions [1.4K]
<span>d.involves accumulation of rhodopsin</span>
5 0
3 years ago
Which scenario MOST LIKELY represents genetic drift and why?
Dahasolnce [82]

Answer:

I think b

Explanation:

I think b I am not so sure

8 0
2 years ago
Read 2 more answers
among the typical midlife changes for men are a(n) . a. loss of body fat b. increase in testosterone production c. increase in p
Tcecarenko [31]

Among the typical midlife changes for men is an Increase in prostate size.

A portion of the fluid that carries sperm during ejaculation is produced by the prostate, a gland. The urethra, which is the tube through which urine leaves the body, is surrounded by the prostate gland.

As you get older, your chances of having an enlarged prostate go up. Because BPH is so common, it has been said that if a man lives long enough, he will all have an enlarged prostate. Many men over 40 have a small amount of prostate enlargement. The condition affects more than 90% of men over the age of 80.

Know more about prostrate here: brainly.com/question/29494316

#SPJ4

4 0
1 year ago
Other questions:
  • PLEASE HELP ME I'LL MAKE YOU BRAINLIEST!!!!!!!!!! Lichens can best be described by which of the following? a) autotrophic organi
    10·2 answers
  • F2 plants segregate 9/16 colored: 7/16 colorless. If just one colored plant from the F2 generation is chosen at random and self-
    5·1 answer
  • An observation that utilizes counting of objects or makes a measurement is
    7·1 answer
  • In gymnosperms, the outer tissues of the seed that aid in dispersal and the inner tissues that serve as a store of nutrients for
    12·1 answer
  • The wicked witch and the big bad wolf are examples of
    5·2 answers
  • The pathophysiology instructor will emphasize that the cells of the proximal tubule have a fine, villous structure that increase
    9·1 answer
  • Deciduous vegetation can play a large role in building design as a result of its ability to: a. increase interior lighting level
    13·1 answer
  • Bradley improved his hitting after taking batting practice. A. Bradley improved his hitting B. after improvement C. taking batti
    11·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • How do individual’s affect environmental systems?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!