1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amid [387]
3 years ago
11

What can usually be determined by observing an organism?

Biology
1 answer:
Shtirlitz [24]3 years ago
5 0

Answer: A. Phenotype

Explanation:

Phenotype: the set of observable characteristics of an individual resulting from the interaction of its genotype with the environment.

Genotypes produce phenotypes.

You might be interested in
Help me please!!! I need this
Alenkasestr [34]

Answer:

The correct answer is - option A. 1 (ovary).

Explanation:

Oocytes or egg are produced in the ovaries during the process of the female gametogenesis in female reproductive system. Ovaries are located on each side of the uterus that are oval and small in shape and size and located lower abdomen.

Among other female reproductive organs these are located above others. The ovaries produce oocytes and hormones It is the site at which primordial germ cell (PGC), become primary oocytes.

Thus, the correct answer is - option A. 1 (ovary).

7 0
3 years ago
HELP <br> I WILL GIVE YOU BRAINLIEST <br><br> 1,2,3,4
Black_prince [1.1K]

Answer:

1111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111¹1111111111111

6 0
3 years ago
A/An _______ forms around a well when the water table begins to slope toward the well.
erica [24]

Answer: ground water

Explanation:

7 0
3 years ago
Read 2 more answers
If a scientist is studying the attraction of water molecules to each other, what property is he or she studying?
gtnhenbr [62]

Answer: Cohesion

Explanation:

The cohesive attraction or cohesive forces is the action or property of like molecules which stick together.

It can be intrinsic forces that can be caused by the structure and shape of water. This allows the water molecules to stick to each other.

Due to this phenomenon of water it has a spherical shape and it flows in a liner motion.

Hence, the force that is present between two water molecules is cohesion.

8 0
3 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
Other questions:
  • PLEASE HELP ASAP!! Jared decides to spray weed killer in his driveway to get rid of weeds popping up through the concrete. Most
    7·1 answer
  • A substance will have a relatively rigid, unchanging shape when it is a
    5·2 answers
  • Why do wilting of leaves take place in hot summer days?
    5·2 answers
  • What are the learning capabilities of the different types of animals?
    12·1 answer
  • People collect information for observation through there
    7·1 answer
  • Explain unsaturated, saturated, and trans fats.
    5·1 answer
  • Which of the following is a statistical
    8·1 answer
  • Evaluate the model.select that do NOT accurately identify the structures labeled in the picture. Choose all that apply.
    12·1 answer
  • Help pls'll give brainlest
    6·1 answer
  • Name the three sub-atomic parts of an atom, and state where they are found in the atom and what their electrical charges are.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!