1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mademuasel [1]
3 years ago
15

Match the time period with the correct layer of fossils (mya = millions of years ago). ITEM BANK: Move to Bottom 175 mya250 mya4

00 mya 175 mya 0
Biology
1 answer:
Marrrta [24]3 years ago
3 0

Answer:

0 mya, 175mya, 250mya, 400mya

Explanation:

The substance which highest million year ago should be more in-depth in the soil hence 400mpa should occupy the highest depth below the ground.

You might be interested in
Most fungi is spread throughout the world by
lana [24]
Most fungi is spread throughout the world by
A. Animals ??
7 0
3 years ago
Read 2 more answers
The Neanderthal copy of a gene crucial for language (FOXP2) more closely resembles the same gene in chimpanzees than in humans,
liraira [26]

Answer:

b. False

Explanation:

FOXP2 gene is required for language and speech development and is present in all animals. It is a transcription factor which encodes for a regulatory protein. Both modern humans and Neanderthals share FOXP2 gene which differs from chimpanzee version by two amino acids. Its the different regulation of the same gene which made modern humans more capable of  using language and speech. Neanderthals did use language rudiments but not completely constructed languages. There might be other speech genes involved too which differed between modern day humans and Neanderthals but not FOXP2.

3 0
3 years ago
What is an ecological system called that consists of all of its biotic and abiotic factors?
mestny [16]
I would say ecosystem.
3 0
2 years ago
Read 2 more answers
HELP!
Lena [83]
All species in the same area
4 0
2 years ago
Read 2 more answers
In order for P. multocida to survive and carry out cellular functions (and cause infection), the energy contained in each molecu
AVprozaik [17]

Answer:

Allosteric inhibition can be reversed.

The allosteric inhibitor binds to a site distinct from the active site resulting in decreased affinity of the enzyme for the substrate.

Allosteric inhibition can be irreversible

8 0
3 years ago
Other questions:
  • Which of the following is NOT a structural modification of the small intestine that increases surface area?
    15·1 answer
  • Responding to the environment by maintaining a stable internal environment despite changing external conditions is
    11·1 answer
  • Which fungi are enclosed by cell walls containing the polysaccharide
    13·1 answer
  • In which main regions of the kidney are the collecting ducts and the loop of henle located
    12·1 answer
  • Male has 23 pairs of chromosomes and female has 23 pair of chromosomes. Then why don’t an offspring have 46 pairs of chromosomes
    15·1 answer
  • Atmos that have gained or lost electrons are called
    7·1 answer
  • Which of the folowing groups of bacteria a predominant in all dental plaques
    14·1 answer
  • What is a health claim? What is a structure-function claim? What kind of claim is made on the Enviga® label, if any? List  othe
    8·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • A large protein needs to enter a cell to help preform a function explain what process the cell must use to allow the protein to
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!