1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GrogVix [38]
3 years ago
8

Why might it be beneficial for each firefly species to have its own unique light pattern?

Biology
2 answers:
AVprozaik [17]3 years ago
7 0
<span>Fireflies use the bioluminescence to attract mates for mating hence key in reproduction. Therefore, beetles from different species should have different lighting patterns so that they can only attract mates of the same species. This would avoid interspecies mating which would probably involved expending energy in produce nonviable offspring which is inefficient (hence will be unfavoured natural selection).    </span>
Neporo4naja [7]3 years ago
7 0
Every firefly species has their own unique light pattern, so they can attract mates of the same species. The flashing is helpful when they need to find each other in the dark. <span> Female fireflies choose their mates depending upon specific male flash pattern characteristics.</span>
You might be interested in
Which is a pollutant associated with high-tech gadgets in landfills?
Harman [31]

Answer:

The answer is D.) Mercury

3 0
3 years ago
Read 2 more answers
Our Sun is considered a(n) _____ star. A. small B. large C. giant D. average
Gala2k [10]
The sun is considered a giant star so C)
6 0
3 years ago
Read 2 more answers
Which discovery supported the endosymbiotic theory?
alexdok [17]

The right answer is A.) DNA in mitochondria .

Eukaryotic cells, with their many intracellular organelles, have long been considered progeny of prokaryotes that would have become more complex as a result of genetic mutations. But from the 1960s, biologist Lynn Margulis proposed an alternative explanation that was first received coldly by the scientific community. His endosymbiotic theory, proposed in a more formal way in a 1981 book, proposes that eukaryotic cells as we know them today would be the result of a series of symbiotic associations with different prokaryotes.

Mitochondria and chloroplasts also have their own DNA that is not trapped in a nucleus, which is also the case with prokaryotes. However, the proteins encoded by this DNA do not cover all mitochondrial proteins. The prokaryote is thought to have lost some genes to the nucleus of the cell, a process known as "endosymbiotic gene transfer". For this reason, mitochondria and chloroplasts are now host-dependent for the synthesis of most of their components.

3 0
3 years ago
Read 2 more answers
Climatic regions are classified according to temperature and __________.
ioda
Precipitation.....................
7 0
3 years ago
Read 2 more answers
Evidence of Evolution in the human body?
expeople1 [14]

Answer:

Another type of evidence for evolution is the presence of structures in organisms that share the same basic form. For example, the bones in the appendages of a human, dog, bird, and whale all share the same overall construction ([Figure 2]). That similarity results from their origin in the appendages of a common ancestor.

Explanation:

Hope it helps :)

Pls mark brainliest :P

4 0
2 years ago
Other questions:
  • Chesapeake Bay Blue Crab Population
    8·2 answers
  • Do both lemurs and humans have the trait listed at point D?
    9·1 answer
  • Which life characteristic describe a long-term response to the environment
    14·2 answers
  • What do atoms have an equal number of?
    11·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What is species distribution?
    8·2 answers
  • If the number of trees on earth continues to decrease significantly, what might be the result?
    7·2 answers
  • What is the opposite of fragmentation​
    13·2 answers
  • Which of the following is a function of intercellular connections?
    8·1 answer
  • As a result of crossing two hterozygous yellow garden peas, 120 offspring are produced. What is the phenotypic ratio of these of
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!