1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lana66690 [7]
3 years ago
8

Why are natural disasters in the west coast more dangerous than the ones in the East Coast

Geography
1 answer:
Sonja [21]3 years ago
7 0

Answer:

The east are closer to the equator.

You might be interested in
What is greenhouse gas
FrozenT [24]

Answer: Bassically, certain gasses like CO2 (Carbon Dioxide) that come from stuff like burning fossil fuels and global warming, they heat up the earth, are wastes and are used as fuel.

4 0
3 years ago
Read 2 more answers
Describe the major change that has been brought about by NAFTA.
erastova [34]

<span>The North American Trade Agreement  (NAFTA), is an economic organization that implements policies for open trade between </span><span>Canada, United States, and Mexico. Through liberalization, the countries were able to have mutual benefits.
</span><span>
</span><span>The three countries benefited from the trades through increase production, more jobs and better conditions in businesses.</span>
<span>
</span><span>
</span>
6 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Open the USGS Earth Explorer interactive map. Scroll down to reveal the map's zoom feature. At the top right corner of the map,
Tomtit [17]

Answer:

chop chop get this hurry

chop chop get this hurry

Explanation:

chop chop get this hurry

chop chop get this hurry

chop chop get this hurry

chop chop get this hurry

chop chop get this hurry

chop chop get this hurry

chop chop get this hurry

chop chop get this hurry

chop chop get this hurry

chop chop get this hurry

chop chop get this hurry

chop chop get this hurry

chop chop get this hurry

chop chop get this hurry

4 0
2 years ago
Which describes uniformitarianism? A. The rates of geologic processes slow down with time. B. The rates of geologic change incre
NARA [144]
D. Geologic processes are different over time
4 0
3 years ago
Read 2 more answers
Other questions:
  • Cuba's Batista era is best described as a period of __________. widespread economic reforms under a communist system B. economic
    9·2 answers
  • According to the following map showing how much renewable energy is used by the countries of Europe, which of the following coun
    8·2 answers
  • A. Name the geometric shape modeled by a colored dot on a map used to mark the location of a city. A. point B. line segment c. p
    6·1 answer
  • How long did hurricane Katrina give it’s rain and wind to New Orleans and the surrounding area
    12·1 answer
  • Analogy - Porosity is to holes as permeability is to _
    7·1 answer
  • Which kind of map uses contour lines to show elevation?
    14·1 answer
  • The first successful British colony in North America was at Jamestown, Virginia. The Virginia Company was given a
    12·1 answer
  • Qual e a capital de japão​
    11·1 answer
  • The Earth from space titled June Twenty-first. A red line is drawn horizontally through the middle of Earth. The Northern and So
    14·2 answers
  • Help pls
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!