There are four gas giants<span> in our Solar System – Jupiter, Saturn, Uranus, and Neptune. The </span>gas giants<span> in our Solar Systems have a number of similar </span>characteristics<span>.
hope dis helps</span>
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
A. The ecosystem can support fewer foxes than grasshoppers.
Explanation:
Since the energy has to transfer from organism to organism, it reduces in amount. Since there are more grasshoppers than foxes, than the ecosystem can support grasshoppers easily.
Answer: Commonly known as deadly nightshade, belladonna, devil's cherry, and dwale. One of the most toxic plants found in the Western Hemisphere, all parts of the plant contain tropane alkaloids – as do those of its equally deadly sister species A.
Explanation: It contains several toxic alkaloids including coniine and is poisonous to humans and livestock. Consumption of just a small amount of any part of the plant can cause respiratory paralysis and death. Poison hemlock, with its purple-blotched stems, can cause paralysis if ingested.
