1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katarina [22]
3 years ago
8

PLEASE HELP, I only have one attempt

Biology
1 answer:
Hatshy [7]3 years ago
3 0

Answer:

C Commensalism

You might be interested in
Bacteria consist of a single cell and have no nucleus. What are bacteria called? A. Organelles B. Multicellular C. Eukaryotes AN
Reika [66]
Prokaryotes.
I should be correct. 
7 0
3 years ago
Read 2 more answers
Explain why changes in climate can result in the extinction of a species.
klasskru [66]
The changes in environment can cause the raising of the sea level, which can push animals further inward, which in turn destroy habit, as they began to get clumped together vegetation begins to go away, thus resulting in less species, also hotter climate makes sure that animals with very heavy coats of fur, die out pretty quickly if not cooled (over heating)<span />
5 0
3 years ago
Read 2 more answers
What are The three major plant organs
nekit [7.7K]
Roots
leaves
the stem
reproductive organs, such as male and female sex organs in flowers.
8 0
3 years ago
Read 2 more answers
The disease cystic fibrosis (CF) is caused by a mutation to the CFTR gene which affects the respiratory, endocrine, reproductive
Lady bird [3.3K]

Answer: DF508 mutation. A Genetic, Hereditary, Autosomal and Recessive Mutation.

Explanation:

Cystic fibrosis (CF) is a recessive autosomal lethal disease, it is most common on Caucasoid populations. Its diagnosis is suggested by the clinical features of chronic obstructive pulmonary disease, persistent pulmonary colonization (particularly with mucoid Pseudomonas strains), meconium ileus, pancreatic insufficiency with or familiarity history of the disease. The FC gene is large, with about 250 Kb of genomic DNA, 27 exons representing about 5% of genomic DNA; encodes a 6.5 kb transcribed mRNA. This mRNA is transcribed into a protein of 1480 amino acid called CFTR (Regulator Transmembrane Conductance Cystic Fibrosis). When a three-base pair deletion, adenosine-thymine-thymine (ATT) identified in the CFTR gene, exon 10, it results in the loss of a single amino acid phenylalanine at position 508 of the protein. This mutation is called DF508; “D” stands for deletion and “F” for phenylalanine amino acid.

4 0
3 years ago
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
Other questions:
  • Recombinant dna technology can be most accurately defined as the
    8·1 answer
  • How long is it between low tides for most places on earth?<br><br> A. 12 hours <br> B. 24 hours
    12·2 answers
  • Which of these help in the asexual reproduction of black bread mold
    5·1 answer
  • I REALLY NEED HELP!!!!!!!!
    8·1 answer
  • Place the events in the correct order:
    15·1 answer
  • List three ways by which eukaryotes process mRNA after transcription.
    7·1 answer
  • Money feed on both plants and animals therefore man is said to be a/an​
    7·1 answer
  • Osmosis worksheet. I need help in this. Please
    9·1 answer
  • PLEASE HELP!!!<br>How do the Aleutian volcanoes differ from the Cascades volcanoes?
    5·1 answer
  • How are Zinc and Sodium alike
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!