1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Veseljchak [2.6K]
3 years ago
14

Faster growing trees demand for wood can be met by trees that grow faster than average. Genetic engineering has produced trees t

hat can ward off biological attacks, grow more quickly and strongly and creat better wood than trees that are not genetically modified. Do you think this is a good thing? Why or why not?
Biology
1 answer:
Yuliya22 [10]3 years ago
5 0

Answer:

Well, on one hand, this is a good thing as negative effects of the high demand for wood such as deforestation can be minimised. This will also sustain the supply of wood for several applications. However, there could be negative consequences of propagating such genetically-modified trees, which were not stated or are not yet known. For instance, the trees could be extreme soil nutrient consumers—depleting soil nutrients at a faster rate than they can be replenished and rendering such soil infertile in a short period.

You might be interested in
If you've ever felt judged on social media because of your parenting style, could you tell us who the bullies were? Is it other
PolarNik [594]
Parents who belong in certain parenting groups because of your style in parent hood
6 0
3 years ago
3. Which statement concerning an ecosystem is correct?
brilliants [131]

Answer:

C) It involves interactions between biotic and

abiotic factors.

Explanation:

Ecosystems need energy imput, need both consumers and producers, and can exist on land, lakes, rivers and oceans.

6 0
2 years ago
Why is carbon the backbone of liveing things
Lyrx [107]
Because of its ability to form large complex and diverse molecules
3 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
In 1783 Antoine Lavoisier showed that the heat produced by respiration was comparable to the heat produced when charcoal was bur
umka21 [38]

Answer: B. Combustion

Lavoisier’s oxygen theory of combustion was one of his most notable contribution to science and earned him the title of the “father of modern chemistry”. He recognized the combustible property of oxygen and that phosphorus and other metallic elements increased in terms of weight when burned.  

5 0
3 years ago
Read 2 more answers
Other questions:
  • What is the outside of DNA called
    12·1 answer
  • Which category of carbon-based molecules includes sugars and starches?
    10·1 answer
  • An allergic reaction to certain cosmetics or chemicals that cosmetologists may be susceptible to is called:
    14·1 answer
  • The total economic value of an ecosystem:
    15·1 answer
  • Explain why the chromosomes in the haploid cells that are produced by meiosis I look different than those produced by meiosis II
    10·2 answers
  • Which of the following statements about the import of protein to the nucleus is correct? Choose all that apply. a. An NLS can be
    14·1 answer
  • In this lesson you watched a movie of children rolling a ball over the surface of a spinning merry-go-round. Describe the appare
    5·1 answer
  • Which of these terms describe the data? Check all that apply.
    9·1 answer
  • Water and food are both examples of _____ factors.
    7·1 answer
  • What are the thin fibers of the human nervous system called?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!