1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ganezh [65]
3 years ago
10

The ovaries are small organs that produce egg cells in females. Removal of

Biology
1 answer:
nlexa [21]3 years ago
3 0

Answer:

B

Explanation:

if you were a female and had this done to you, you would then understand.

You might be interested in
Which statement best describes a bacteriophage? select all that apply
Arada [10]

Answer:

can not answer without the rest of the question

Explanation:

3 0
3 years ago
7. (True Story) In Denmark, a husband and wife who had been unsuccessfully trying to have a
ratelena [41]

Answer:a

a possible explanation for this occurrence is that a test tube or dropper was accidentally used repeatedly without being sterilized, causing sample cross-contamination. DNA in this test case did not confirm that the father of the second child was another client of the fertility clinic who had never met the mother...therefore this is a possibility.

Explanation:

4 0
3 years ago
Which of the following would have resulted from the functions of prokaryotes on early earth?
Vitek1552 [10]
Not sure what the following is, but I think it could be less carbon in the soil 

3 0
3 years ago
Read 2 more answers
This is the foundation for DNA replication, the rule that states the pure adenine (A) always pairs with the pyrimidine thymine (
Alenkasestr [34]
It might be always pairs with the purine guanine

6 0
3 years ago
Read 2 more answers
Chlorophyll is most abundent in the blank of a plant
Vesnalui [34]
Well it can be found in cyanobacteria and the chloroplasts of algae and plants.
8 0
3 years ago
Other questions:
  • Anesthesia reimbursement a needle biopsy, lasting 15 minutes, was performed in portland, or, on a 75-year-old patient. the basic
    5·1 answer
  • Proteins are broken down into _____ that can be actively transported across the intestinal wall.
    7·1 answer
  • How do organisms release energy in food to make it useful?
    12·2 answers
  • State whether the following are Tue or False
    5·2 answers
  • What is the number of this particle in a carbon atom?
    9·1 answer
  • All of the following contribute to the decrease of biodiversity EXCEPT - ( NEED ASAP )
    6·1 answer
  • When a gasoline engine burns gasoline, what type of chemical reaction is occurring?
    15·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which of these resources CANNOT be produced sustainably?
    8·1 answer
  • Which of these factors is involved in earthquake formation?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!