1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Papessa [141]
3 years ago
7

Which of the following best describes a traditional economy?

Geography
1 answer:
Snowcat [4.5K]3 years ago
8 0
The answer for your question this the first one witch is (A)
You might be interested in
What are mid-ocean ridges created by?
IgorLugansk [536]
The answer is B.....
3 0
3 years ago
1. The earliest inhabitants of Australia were the________​
ddd [48]
Search Results
Featured snippet from the web
People have lived in Australia for over 65,000 years. The first people who arrived in Australia were the Aboriginal people and Torres Strait Islanders.. They lived in all parts of Australia.
5 0
3 years ago
Read 2 more answers
Are dogs allowed to walk up to the Hollywood sign with their owner?
Evgen [1.6K]
I believe that dogs are allowed too
8 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
State one feature of a drainage basin. <br> (write in your own words)
vova2212 [387]
Drainage basin - the area of land drained by a river.
Catchment area - the area within the drainage basin.
Watershed - the edge of highland surrounding a drainage basin which marks the boundary between two drainage basins.
Source - the beginning or start of a river.
Confluence - the point at which two rivers or streams join.
Tributary - a stream or smaller river which joins a larger stream or river.
Mouth - the point where the river comes to the end, usually when entering a sea.

Hope this helped :)
6 0
3 years ago
Other questions:
  • In which geographic region of Oklahoma will you find Lake Texoma?
    9·1 answer
  • Why i cant go to anime worlds...​
    11·2 answers
  • What is nature's most violent storm? <br> a. wildfire. <br> b. tornado. <br> c. earthquake.
    8·1 answer
  • How did the United States manage to expand its territory across the continent
    11·2 answers
  • ¿Cuántos ojos y dientes tiene un cíclope?
    6·1 answer
  • Which BEST explains why a terrorist group might target a region's infrastructure?
    10·1 answer
  • Most of New Zeland's land supports which economic activity?
    10·2 answers
  • 16. What is the likely impact of the numerical change by 2050 of the total population on the eventual shape of Japan's populatio
    11·1 answer
  • PLS HELP ASAP!!!!
    7·2 answers
  • Which term describes the rock that will eventually form from the sediment
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!