1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tester [92]
3 years ago
14

Artificial wetlands ________. are the major program for replacing lost natural wetlands purify water for use as bottled drinking

water are a source of arsenic contamination in Bangladesh are created using xeriscaping methods can help purify water and also provide wildlife habitat
Biology
1 answer:
zmey [24]3 years ago
3 0
Artificial wetlands can help purify water and also provide recreational opportunities. They are the major program for replacing lost natural wetlands purify water for use as bottled drinking water are a source of arsenic contamination in Bangladesh are created using xeriscaping methods can help purify water and also provide wildlife habitat.
You might be interested in
Which of the following accurately describes an example of how materials can move across the cell membrane through active transpo
Zinaida [17]
I am confident that the answer should be.....<span>A protein acts as a pump and moves calcium ions from an area of low concentration to an area of high concentration.


                                      
Hope this helps.
</span>
3 0
3 years ago
Read 2 more answers
Which of the following are types of homogeneous mixtures? (Select all that apply)
Olegator [25]
Hot tea bcs it’s particles distributed non-uniformly ps this might not help yw
7 0
3 years ago
Which joint in the human body has the widest range of movement?
melamori03 [73]

Ball and Socket Joint

This type of joint allows for a wide range of rotation and movement. The shoulder and hip are ball and socket joints.

5 0
3 years ago
Difference between macro algae and salt marsh plants/mangrove trees
Yakvenalex [24]
<span>Although both macro algae and mangrove trees are multicellular and share many of the same structural features, macro algae are not true plants. Also, mangrove trees and marsh plants typically live in brackish water rather than salt water and are not completely submerged, as opposed to macro algae.</span>
3 0
3 years ago
PLEASE I NEED HELP IN THIS ONE ASAP
Vedmedyk [2.9K]

Answer:

im pre sure its genetic mutation

Explanation:

coz it changes the genes in the organism

m

8 0
2 years ago
Read 2 more answers
Other questions:
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • During the earliest stages of the universe, the only things that existed were A) the Sun and the planets. B) helium and hydrogen
    14·2 answers
  • Explain how rheumatoid arthritis causes the symptoms shown in the models. Would the same symptoms occur if the immune system wer
    14·2 answers
  • Describe the two main steps of cellular respiration used by both plants and animals to form ATP. In your description, explain wh
    12·1 answer
  • In addition to the transmission electron microscope (TEM), there is another type of electron microscope that is frequently used
    10·1 answer
  • According to the food web shown, which group below lists only secondary consumers?
    15·1 answer
  • The one specific, identifiable origin of a pollutant is called the __________.
    8·2 answers
  • What are three things you learned about the
    9·1 answer
  • Somebody help me so I can give y’all some points
    6·2 answers
  • Which of the following are advantages to living in a highly populated area? (Choose all that apply)
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!