1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jenyasd209 [6]
3 years ago
13

The frequency of sickle-cell anemia, an autosomal recessive condition, is 0.007. Assuming that the population is in H-W equilibr

ium, what is the frequency of the recessive allele that causes the condition? Enter your answer to the nearest 0.001.
Biology
1 answer:
damaskus [11]3 years ago
5 0

Answer:

The correct answer is - 0.084

Explanation:

Sickle cell anemia is a autsmal recessive blood disorder of RBCs where RBC shape altered to the sickle shape or cresecent moon that obstruct and damage the veins and artries.

Normal allele is represented by - HbA - p

sickel cell allele is represented by - HbS - q

genotype frequency of normal allele HbA in the population = p2

genptype frequency of HbAHbS in the population = 2pq

genotype frequency of autosomal recessive HbS = q2 = 0.007 (given)

So, the allelic frequency of the recessive allele =

q =  √ 0.007 = 0.08366 or 0.084

You might be interested in
Explain nutrient recycling and importance of water cycle​
lakkis [162]

Answer:

The nutrient cycle describes the use, movement, and recycling of nutrients in the environment. Valuable elements such as carbon, oxygen, hydrogen, phosphorus, and nitrogen are essential to life and must be recycled in order for organisms to exist.

Explanation:

The nutrient cycle describes the use, movement, and recycling of nutrients in the environment. Valuable elements such as carbon, oxygen, hydrogen, phosphorus, and nitrogen are essential to life and must be recycled in order for organisms to exist.

6 0
3 years ago
Need help<br> need to ask more questions
MrRissso [65]

The conclusion that can be draw from the data above concerning the carnivores and the herbivores is that the carnivores have shorter digestive system than the herbivores. That is option C.

<h3>What are carnivores and herbivores?</h3>

The carnivores are those animals that kill and feed on other smaller animals as their source of food while the herbivores are the animals that feed on plant and plant products.

From the data given above, the herbivores have longer digestive system but are less heavy in weight as when compared with the carnivores.

Also from the data given above, the carnivores have a shorter digestive system but with more weight than the herbivores.

Learn more about carnivores here:

brainly.com/question/24841795

#SPJ1

3 0
1 year ago
Which kingdom in the domain Eukarya best classifies photosynthetic, multicellular organisms that have specialized tissues?
klasskru [66]
Plantea for sure. hope this helped :)
3 0
3 years ago
What type of organisms use cellar respiration
Svetlanka [38]

Answer:

All types of living organisms use cellular respiration for the production of energy from food molecules such as glucose.

Explanation:

Respiration is energy releasing process which occurs in mitochondria of the cell. Respiration has two types i. e. Aerobic and anaerobic respiration. In aerobic respiration, energy is released from the breakdown of glucose molecules with the addition of oxygen while anaerobic respiration is the release of energy from breakdown of glucose molecules without the use of oxygen.

6 0
3 years ago
What could cause a population to reach it's carrying capacity​
DerKrebs [107]

Answer:

As competition increases and resources become increasingly scarce, populations reach the carrying capacity (K) of their environment, causing their growth rate to slow nearly to zero. This produces an S-shaped curve of population growth known as the logistic curve (right).

Explanation:

hope this helps

3 0
3 years ago
Read 2 more answers
Other questions:
  • Am i correct and if i'm not can you help
    10·2 answers
  • The observation an author makes about life in his story is its _____.
    15·2 answers
  • Aluminum is an element. Which best describes what makes up a sample of aluminum?
    15·1 answer
  • Answer For Brainlest, thanks.
    7·1 answer
  • A person who has allergies has a compromised immune system because the body's immune system
    13·1 answer
  • Imagine that you have found the remnants of a robin's egg on the ground. From your biology course, you know that this eggshell i
    11·1 answer
  • What does a virus need to bind to before it can enter host cells
    13·1 answer
  • How many crops are grown in arkansas?
    13·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • In which two ways does a hummingbird’s nervous system help it’s body’s cells get nutrients
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!