1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mashutka [201]
3 years ago
5

How do I file a complaint on brainly? I'm trying to ask a question on biology and it says Im using a phrase that hurts their fee

ling, its annoying.
Biology
1 answer:
Sophie [7]3 years ago
6 0

Answer:

i know it gets really anoying

You might be interested in
How do you calculate surface area to volume ratio of a cylinder?
Molodets [167]
Cylinder Formulas in terms of r and h:<span><span>Calculate volume of a cylinder: V = πr2h.</span>Calculate the lateral surface area of a cylinder (just the curved outside)**: L = 2πrh.Calculate the top and bottom surface area of a cylinder (2 circles): T = B = πr. ...Total surface area of a closed cylinder is:</span>
8 0
3 years ago
Fossil records can be studied to determine how organisms change through time. Which of the following methods for studying organi
Sonbull [250]
Comparing sleep patterns of organisms
5 0
3 years ago
What is the answer??????????
MissTica
What is the question?
8 0
4 years ago
Read 2 more answers
In Which ways is photosynthesis important to life on earth? Check all that apply
rosijanka [135]

Due to photosynthesis, plants convert Sunlight and Carbon Dioxide into Oxygen. All living things breathe in this gas (Oxygen).




8 0
4 years ago
Read 2 more answers
PLS HELP, GIVING BRAINLIEST !!
Kobotan [32]

Answer:

The answer D

Explanation:

The answer is in the question.

3 0
3 years ago
Read 2 more answers
Other questions:
  • What is another term for a fertilized egg? what is the chromosome number of the fertilized egg? (answer this in general terms, h
    8·1 answer
  • What factors threaten the existence of nonhuman primates in the wild? what can you do to help save nonhuman primates from extinc
    8·1 answer
  • Exposed a tax on goods ,such as tea and paper ,imported from Britain ?
    12·1 answer
  • Describe the relationship between Surface Area and Rate of Weathering ?
    7·1 answer
  • Many land plants store energy in starch. When energy is needed, the starch molecules can be broken down quickly. Starch is which
    5·1 answer
  • Why is mitosis important in multicellular organism?
    7·2 answers
  • What are the characteristics necessary to be considers a living thing
    13·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Can the skin from a human be transplanted onto the heart of that same
    12·1 answer
  • Which describes
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!