1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andru [333]
3 years ago
8

Answer this question.

Biology
2 answers:
Deffense [45]3 years ago
7 0

Answer:

Hi, I think it is A) Counting and classifying the debris in the area where the gorillas live.

Explanation:

I am sooooo sorry if I got it wrong! Have a nice day and good luck! :)

TiliK225 [7]3 years ago
6 0
I’m almost positive it’s A
You might be interested in
If an animal eats only meat what would be its source of glucose
ozzi
Protein can be reversed to make glucose so the answer is protein
5 0
3 years ago
which substance is a waste that would normally diffuse across the placenta from the embryo to the mother?
Olenka [21]
That waste product would be carbon dioxide.
3 0
3 years ago
Which of the following are characteristics of
slega [8]

Answer:

b.Grow and change

c.Have a complex chemistry

d.Maintain homeostasis​

Explanation:

5 0
3 years ago
Read 2 more answers
Which is colder the east or west coast of southern Africa.why<br><br>​
Aneli [31]

West Coast water temperatures are much lower than those along the East Coast. ... This means Atlantic waters travel to the U.S. East Coast from the south and are relatively warm compared with West Coast Pacific waters that arrive from the north out of the chilly Gulf of Alaska.

The air above the cold Benguela current and upwelling region along the west coast is relatively dry and cold, contributing to the dry climate of the west coast. Moist air from the warm Indian Ocean and Agulhas Current is frequently transported into eastern South Africa by easterly winds.

Explanation:

hope this helps

pls put brainliest

3 0
3 years ago
Help me please!!!!!!!!
valkas [14]

Answer:

1. process A

Explanation:

2. process B

3. valine

4.mutation

6 0
3 years ago
Other questions:
  • In the inheritance pattern ______ ,
    14·1 answer
  • Pollen is carried from one flowering plant to another by
    7·1 answer
  • Which part of the compound light microscope provides the light source? (4 points)
    10·2 answers
  • Help please biology !!!
    8·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Imagine looking through a microscope at a squashed onion root tip. The chromosomes of many of the cells are plainly visible. In
    11·1 answer
  • 1. Which of the following best explains how Earth’s atmosphere protects life on the planet?
    15·1 answer
  • The two naming system developed by Linnaeus is called
    13·1 answer
  • Describe three functions of the American Kennel Club.
    6·1 answer
  • PLEASE HELP IMSTUCK
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!