True. Faults are associated with,or form, the boundaries between Earth's tectonic plates
"<span>Female cones produce pollen that is trapped by the male cones’ scales" is the one among the following choices given in the question that is true of conifers. The correct option among all the options that are given in the question is the fourth option or the last option. I hope the answer helps you.</span>
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
Please find the explanation below
Explanation:
Deoxyribosenucleic acid, commonly called DNA is the stored form of genetic material in living cells. It contains the information needed by an organism to survive. A segment of the DNA that encodes the necessary information needed to produce a particular protein that determines a trait is called GENE.
The DNA consists of long polynucleotide chains, hence, due to Its length, it cannot git into the cell. The cell then devises a means by wrapping the long strands of DNA around certain proteins called HISTONES. This initially forms a NUCLEOSOME structure, then continuous wrapping around histones and condensation forms the visible CHROMOSOME structure.
Now, the CHROMOSOME contains the DNA molecule, which contains protein-coding segments called GENES. The information contained on the gene is used to produce a protein that is responsible for a particular TRAIT in the organism.
More growth of flowers and or more plant food/water supply for it
