1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alika [10]
3 years ago
9

Select the correct word to complete the sentence.

Biology
2 answers:
Tom [10]3 years ago
8 0

Answer:

I think its homeostatis

Explanation:

umka21 [38]3 years ago
8 0

Answer:

stress?

Explanation:

it isnt homeostasis or hormones or response

since it's a big change and extreme constant changes this seems like stress to the pupfish

i have the same question at the moment and will edit this response if it was right or not

You might be interested in
Which of the following statements regarding glycolysis is FALSE?
Levart [38]

Answer:

c. Glycolysis evolved in an oxygen-rich environment.

Explanation:

Glycolysis is the pathway that breaks down glucose into two molecules of pyruvate. It is a common pathway that is performed by both aerobic and anaerobic organisms. In aerobic organisms, glycolysis is followed by Kreb's cycle and electron transport chain. In anaerobic organisms, alcohol or lactic acid fermentation regenerate the NAD+ which is required to sustain glycolysis.

Therefore, glycolysis is independent of oxygen availability and can be performed under both aerobic and anaerobic conditions. This means that the pathway of glycolysis evolved under anaerobic conditions.

6 0
3 years ago
Which of the following statements reflects a cognitive characteristic that is present during late adulthood?
insens350 [35]
Answer: A
Hope this helps
4 0
3 years ago
Read 2 more answers
Give one reason why structure f(petal) is brightly colored in the diagram?
Marina CMI [18]

Answer:

petals are colorful because the color attracts birds, bees and other insects. The insects land in the flower and spread pollen, which helps fertilize the flowers and create seeds. Some flowers change color as they grow older.

5 0
3 years ago
Photosynthesis is an integral part of what cycle?
kow [346]

Answer:

photosynthesis is a part of the global carbon cycle

5 0
2 years ago
The nurse who works in a birthing unit understands that newborns may have impaired thermoregulation. which nursing interventions
kozerog [31]
Green goo is the answer on e2020
4 0
3 years ago
Other questions:
  • Identify the effects of the disorders that weaken
    12·2 answers
  • A population of beetles are kept in a controlled ecosystem. No beetles are
    12·2 answers
  • The trees in a forest all have closed stomata. what is the cause?
    14·1 answer
  • In chickens, comb shape is determined by alleles at two loci (R, r and P, p). A walnut comb is produced when at least one domina
    13·1 answer
  • The Moon and stars seem to move from _____________________________ to __________________________________ across the night sky
    15·1 answer
  • Chymotrypsin is a digestive enzyme that breaks down proteins in the small intestine. A student runs a computer simulation of chy
    12·1 answer
  • Which wave has the higher frequency A or B?
    9·2 answers
  • 2. Which of the following graphs represents a relation that is not a function?<br> A
    9·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which sentence best explains how a unicellular organism gets nutrients? Explain why.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!