1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kazeer [188]
3 years ago
9

Scientists know that the moon does not have a magnetic field. This probably

Biology
2 answers:
Nata [24]3 years ago
4 0

Answer:

Maybe gravity too

Explanation:

Please give me brainliest

Cloud [144]3 years ago
4 0

Answer:

movement in its core is the answer on A P E X

Explanation:

You might be interested in
Which descriptions apply to Mendel's pea plant experiments? Select three options.
Rina8888 [55]

Answer:

Used cross breeding to purposely breed plants. Studied a variety of pea plant traits. studied several generations of pea plants.

Explanation:

3 0
3 years ago
You observe a high proportion of malarial infections in a small village located in Angola. Malaria is caused by the protozoan Pl
svet-max [94.6K]

Answer:

<em>B and C.</em>

Explanation:

The epidemiological triangle is an illustration of interaction among suitable hosts, disease agents, and the environment that drives successful outbreak of diseases.

In order to successfully tackle or reduce the incidence of a disease, the triangle has to be broken.

<em>In the case of malaria which is caused by plasmodium but spread through the female anopheles mosquito, one way of breaking the epidemiological triangle is to eliminate female anopheles mosquito in the environment using any possible means. This will stop the spread of the parasite and hence, the disease.</em>

<em>Another way to reduce/prevent malaria is to prevent the vector, female anopheles mosquito from getting to the host, the human populace. This can also be achieved by several possible means.</em>

Relocating the entire village to a neighbouring village might not break the epidemiological triangle as long as female anopheles mosquito still abounds. In the same vein, antibacterial drugs will not help to treat malaria. However, instructing residents on personal protective measures and controlling the vector through chemical larvicides will go a long way in breaking the triangle and reducing the incidence on the malaria disease.

<em>The correct options is B and C.</em>

5 0
3 years ago
A scientist discovers a new species near coral reefs in Australia. She finds that this single-celled species is photosynthetic (
pochemuha

Answer:

1. Eukaryotic

2. Eukaryota

Explanation:

1. Eukaryotic- The newly found species has a cell wall and contains membrane-bound organelles. The presence of membrane-bound organelles shows that the cell is a Eukaryotic cell.

2. Eukaryota- the species is single-celled with the presence of cell wall without peptidoglycan. This shows that the species could belong to the Eukaryota domain proposed by Carl Woese.

Thus, 1. Eukaryotic and 2. Eukaryota is the correct answer.

4 0
3 years ago
Ian waterman was able to sense pain and temperature because his _____ pathway was intact, but could not feel touch and limb posi
ANEK [815]
<span>Ian Waterman was able to sense pain and temperature because his spinothalamic pathway was intact, but could not feel touch and limb position because of damage to his lemniscus pathway. </span>

The lateral spinothalamic tract is a sensory pathway which carries sensory information like pain and temperature to the brain, across the thalamus. Free nerve endings which are located in the peripheral tissues are sensitive to cell damage. Those are primary neurons and they pass the sensory signal. Primary neurons synapse with secondary which are located in the spinal cord (white matter). These secondary neurons will ascend through the brainstem, medulla oblongata, pons and midbrain, until synapsing in the ventroposteriorlateral (VPL) nucleus of the thalamus. From the thalamus, the information is sent to cortex (somatosensory cortex).

Posterior column-medial lemniscus pathway is ascending spinal tract, carrying sensory information to the brain (sensory pathway). It conducts localized sensations of fine touch, vibration and proprioception (position sense) from the skin and extremities (muscles) to the central nervous system (cerebral cortex).

8 0
3 years ago
The bacterium, E. coli prefer to consume glucose. If, however, there is no glucose present, they will utilize lactose as an ener
soldi70 [24.7K]

Answer:

Lactose is more likely to be utilised by E. Coli than Arabinose because Lactose will yield more energy (ATP) and lactose breakdown will give glucose and galactose and these will enter into the glycolytic pathways to pyruvate for ATP generation until Arabinose which will undergo Pentose phosphate pathway and this does not produce enough energy.

6 0
4 years ago
Other questions:
  • What is the family of the animal that is land-dwelling and uses scent glands for defense?
    9·2 answers
  • Can someone please help me i would really appreciate it !
    10·2 answers
  • How can mold go into a plastic bag of bread ?
    14·1 answer
  • In humans oxygen and carbon dioxide are exchanged with the atmosphere via the
    14·1 answer
  • What is the specific area of the parietal lobe that is involved in sensation?
    11·2 answers
  • Genetic engineering is the process of manipulating genes for practical purposes. Today, scientists have genetically engineered m
    13·2 answers
  • What is the "scale of cells"?
    5·2 answers
  • How is a recessive allele different from a dominant allele apex?
    10·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • PLEASE HELP PLSSS I need just answer fast
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!