1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SVEN [57.7K]
3 years ago
14

Help me plz asap 2-4 plz

Biology
1 answer:
seropon [69]3 years ago
4 0

Answer:

1.mRNA- ATGAAAAGGTCCGTGGGAACTAAACAACACTAA

2.MRNA- ATGAAAACGGTCCGTGGGAACTAAACAACACTAA

3. ??

4. It will affect the protein so the leg wont have enough protein or have too much.

Explanation:

You might be interested in
Which statement correctly describes glucose (C6H120.?
Afina-wow [57]
The answer is D. The last one.
glucose is a chemical compound made of 6 atoms of carbon 6 atoms of oxygen and 12 atoms of hydrogen.
5 0
4 years ago
Read 2 more answers
Can someone tell me if this is right plzz
11111nata11111 [884]

Answer:

Maybe but double check

Explanation:

5 0
3 years ago
Explain why some traits cannot be easily changed even though they are heritable
Marta_Voda [28]
Traits heritable only if the similarity arises from shared genotypes
4 0
3 years ago
Metacognition is _____. the ability to process multiple stimuli the process of putting information into long-term memory the pro
Alborosie
Metacognition is “thinking about thinking” (or "knowing<span> about knowing")</span>. <span>Metacognition is defined as the knowledge we have about our own cognitive processes, like thinking. It includes knowledge about when and how to use particular strategies for learning or for problem-solving. It is also the ability to control our thinking processes through strategies, such as organizing, monitoring or adapting.</span>
8 0
4 years ago
Molecules may be assembled into a microscopic structure called a(n) blank which carries out specific functions within a cell.
Semmy [17]
Cells are combined in a structure called tissue wich have the same properties like the cells wich are formed by.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following accurately describes the process of translation? A. Each tRNA molecule has a codon that matches an mRNA a
    7·2 answers
  • What do we call a genetic cross that follows two separate characters, such as pea seed color and pea seed shape?
    12·1 answer
  • A hydrocarbon has molecular formula C3H8. Identify the class of hydrocarbons it belongs to.
    7·1 answer
  • What would be the answer to Friday?
    5·2 answers
  • they went home and found that their mother is using a plunger because the kitchen is blocked.They have two diffrent size of plun
    13·1 answer
  • What is a dependent variable in biology?
    9·1 answer
  • What impact do trees have on the food web?
    9·2 answers
  • Why do animals exist in various species
    14·1 answer
  • A tsunami is caused by an _______________________ or a _______________________ underwater that displaces water, generating a wav
    6·1 answer
  • Somebody help me so I can give y’all some points
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!