1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vladimir2022 [97]
3 years ago
10

There was snow and a 25 mph wind on Monday. On Tuesday, there was rain and a 10 mph wind. Which changes to the weather component

s most likely caused the changes in weather?
A) The temperature of the air increased, and the difference in pressure between the low pressure and the high pressure systems became small.
B) The temperature of the air increased, and the difference in pressure between the low pressure and the high pressure systems became large.
C) The temperature of the air decreased, and the difference in pressure between the low pressure and the high pressure systems became small.
D) The temperature of the air decreased, and the difference in pressure between the low pressure and the high pressure systems became large.
Biology
1 answer:
maksim [4K]3 years ago
5 0

Answer:

B I Took The Test An My teacher Say It Right

Explanation:

You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Diagram 1 shows the tilt of Earth's axis. Diagram 2 shows how Earth would look if the tilt of the axis were increased. Each diag
sweet-ann [11.9K]

Answer:

confused

Explanation:

7 0
3 years ago
100 points hurry will mark as brainliest⁉️⁉️⁉️⁉️
weqwewe [10]

Answer:

when refering to growth the cells get bigger rather than multiplying, when talking about development, the cells multiply rather than enlarge

Explanation:

6 0
3 years ago
Read 2 more answers
Tim wants to perform an experiment with yeast. He forms a hypothesis in which he predicts that all of the yeast will eventually
Olin [163]

Answer:

answer c

Explanation:

4 0
3 years ago
Which of the following determines the carrying capacity of a particular population by an ecosystem?
Elza [17]
Limiting factors determine the carrying capacity Hope this helps :)
5 0
3 years ago
Read 2 more answers
Other questions:
  • An iodine test of a tomato plant leaf revealed that starch was present at 5:00 p.m. on a sunny afternoon in July. When a similar
    6·2 answers
  • True or false?
    7·1 answer
  • Some areas of an ocean are known as dead zones. These zones form when excess organic material decomposes. This increased decompo
    13·2 answers
  • Which of the following statements describes the most likely selective pressure behind the evolution of feathers?
    8·1 answer
  • How can the fossil record provide evidence for evolutionary relationships?
    10·2 answers
  • How was the earth first formed?
    9·1 answer
  • Plzzzzzz hellppp wahtttt
    11·1 answer
  • For a cell to produce a current, the electrodes of the cell must ____.​
    12·1 answer
  • Could I pls get help??
    5·1 answer
  • If there was a dramatic increase in skeletal muscle cell damage and apoptosis, what would you expect to happen to levels of myog
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!