1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blababa [14]
3 years ago
5

Examine the data table for optimal ranges of environmental conditions for aquatic species. A student wants to

Biology
1 answer:
Airida [17]3 years ago
7 0

Answer:

A&B

Explanation:

Plants will thrive and Bacteria will thrive

You might be interested in
In dividing cells, most of the cell's growth occurs during “_____”
7nadin3 [17]

Answer:

In dividing cells, most of the cell's growth occurs during interphase. 5. The mitotic spindle(s) is a cell structure consisting of microtubules, which forms during early mitosis and plays a role in cell division.

5 0
3 years ago
What nervous system is controlled by the hypothalamus?
Dahasolnce [82]

Answer:

The hypothalamus is the key brain site for central control of the autonomic nervous system, and the paraventricular nucleus is the key hypothalamic site for this control.

Explanation:

7 0
3 years ago
What would happen to the proton gradient and ATP production after a drug has poisoned the enzyme that combines acetyl CoA and ox
Dmitriy789 [7]

Answer:

The proton gradient becomes weaker

Reduction in the amount of ATP produced.

Explanation:

The combination of acetyl CoA and oxaloacetate drives the formation of nicotinamide adenine dinucleotide + hydrogen (NADH). Poisoning the enzyme that aids this combination will result to lesser production of NADH which would lead to weakening the proton gradient and the reduction in the amount of adenosine triphosphate (ATP) produced.

3 0
3 years ago
Is human skull prokaryotic or eukaryotic?
Alenkasestr [34]

Answer:

eukaryotic

Explanation:

8 0
2 years ago
Read 2 more answers
Which of the following are examples of organic carbon?
bearhunter [10]

D, Both A and C, if you watched ms q's nice video, she basically gave this answer right out

5 0
4 years ago
Other questions:
  • Which statement explains why the same side of the moon is visible from earth every night
    7·2 answers
  • Many toxins and poisons block certain enzymes in the mitochondria. For example, many fruits, including apricots, apples, plums,
    14·1 answer
  • Which was first launched during the Space Race?
    11·1 answer
  • Which of the following processes releases carbon dioxide into the<br> atmosphere?
    10·1 answer
  • All of the weather on Earth occurs in the thermosphere. <br> a. True<br> b. False
    14·2 answers
  • Austin and Marissa hypothesize that coneflower stomata use feedback loops to respond to moisture levels by opening when there is
    11·1 answer
  • Please help me answer this
    13·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What is a organelle? Give an example(if you can)<br>​
    11·1 answer
  • Explain chargaff’s rule for base- pairing ( pls help due right now lol ) ( ◠‿◠ )
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!