1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Juli2301 [7.4K]
3 years ago
9

The following includes the steps that should be taken when blood is found at a crime scene EXCEPT

Biology
1 answer:
lisabon 2012 [21]3 years ago
7 0

Answer:

confirm the point of origin

You might be interested in
Imagina que un contaminante no biodegradable es arrojado al agua de este ecosistema. ¿Qué puede ocurrir con esté contaminante en
Marina86 [1]
What is that ???? Makes no sense
5 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Leukopenia is a condition characterized by a decrease in white blood cells. What effect does leukopenia have on the body's abili
Korolek [52]

Leukopenia means  a low count of white blood  cells in the body. When there is a low white blood cell count in the body, and in particular a low level of neutrophils (a kind of white blood cell that fights infection), there is quite a significant risk of developing an infection, and once an infection is developed and the white blood cell count is low, the body will not be able to protect itself and fight off the infection. In severe cases , infection may lead to death.


6 0
4 years ago
Read 2 more answers
In the history of Earth and the evolution of cells, aerobic cells appeared first and anaerobic cells appeared later.
Andreas93 [3]

Answer:

False

Explanation:

Scientist believe that the primitive atmosphere lacked free oxygen. Oxygen is a highly reactive molecule that would have made difficult for complex macromolecules to appear and then create life.  Rocks from the precambrian period support this theory.

Anaerobic cells appeared first, then photosynthesis appeared filling the atmosphere with oxygen and the aerobic organism develop cellular respiration to obtain energy, a process more efficient than anaerobic respiration.

4 0
3 years ago
What does scoliosis stand for?
mart [117]

Answer: hope that helps

Explanation: Scoliosis is a sideways curvature of the spine that occurs most often during the growth spurt just before puberty. While scoliosis can be caused by conditions such as cerebral palsy and muscular dystrophy, the cause of most scoliosis is unknown.

WOOOAH

3 0
3 years ago
Read 2 more answers
Other questions:
  • The cell membrane(or plasma membrane) is the outermost covering of a cell it protects the cell from the external environment it
    7·1 answer
  • What roles do prokaryotes play in ecosystems?
    15·1 answer
  • Cross<br> . Where life most likely originated.
    12·1 answer
  • Why does the fact that the red cells have different proteins to the white cells alter the function of the cell ?
    14·1 answer
  • Complete the sentence: I need to be science literate in order to
    14·1 answer
  • ________ is a condition in an experiment that remains the same.
    14·1 answer
  • Which of the following statements is true?
    9·2 answers
  • PLEASEEE HELPPPPPPPPPP​
    15·1 answer
  • A.
    6·2 answers
  • Define <br> Bilateral<br> Hypoventilation<br> Hemothorax<br> Arrhythmias
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!